ID: 907268047

View in Genome Browser
Species Human (GRCh38)
Location 1:53274759-53274781
Sequence GTGGCAAGCGCGTGGACGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 53}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907268047_907268054 -1 Left 907268047 1:53274759-53274781 CCCGCCGTCCACGCGCTTGCCAC 0: 1
1: 0
2: 1
3: 0
4: 53
Right 907268054 1:53274781-53274803 CTCTTACACTGAAATCTGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 224
907268047_907268056 11 Left 907268047 1:53274759-53274781 CCCGCCGTCCACGCGCTTGCCAC 0: 1
1: 0
2: 1
3: 0
4: 53
Right 907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG 0: 1
1: 0
2: 0
3: 4
4: 55
907268047_907268052 -3 Left 907268047 1:53274759-53274781 CCCGCCGTCCACGCGCTTGCCAC 0: 1
1: 0
2: 1
3: 0
4: 53
Right 907268052 1:53274779-53274801 CACTCTTACACTGAAATCTGCGG 0: 1
1: 0
2: 0
3: 14
4: 155
907268047_907268055 10 Left 907268047 1:53274759-53274781 CCCGCCGTCCACGCGCTTGCCAC 0: 1
1: 0
2: 1
3: 0
4: 53
Right 907268055 1:53274792-53274814 AAATCTGCGGGGACCCTCACAGG 0: 1
1: 0
2: 0
3: 2
4: 59
907268047_907268061 28 Left 907268047 1:53274759-53274781 CCCGCCGTCCACGCGCTTGCCAC 0: 1
1: 0
2: 1
3: 0
4: 53
Right 907268061 1:53274810-53274832 ACAGGGTGACTCTGTTGGGCCGG 0: 1
1: 0
2: 1
3: 62
4: 570
907268047_907268058 23 Left 907268047 1:53274759-53274781 CCCGCCGTCCACGCGCTTGCCAC 0: 1
1: 0
2: 1
3: 0
4: 53
Right 907268058 1:53274805-53274827 CCCTCACAGGGTGACTCTGTTGG 0: 1
1: 0
2: 1
3: 17
4: 133
907268047_907268060 24 Left 907268047 1:53274759-53274781 CCCGCCGTCCACGCGCTTGCCAC 0: 1
1: 0
2: 1
3: 0
4: 53
Right 907268060 1:53274806-53274828 CCTCACAGGGTGACTCTGTTGGG 0: 1
1: 0
2: 0
3: 26
4: 311
907268047_907268053 -2 Left 907268047 1:53274759-53274781 CCCGCCGTCCACGCGCTTGCCAC 0: 1
1: 0
2: 1
3: 0
4: 53
Right 907268053 1:53274780-53274802 ACTCTTACACTGAAATCTGCGGG 0: 1
1: 0
2: 1
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907268047 Original CRISPR GTGGCAAGCGCGTGGACGGC GGG (reversed) Intronic
901791440 1:11655295-11655317 GTGGCAAGAGGGTGGGCGACAGG - Intronic
901973310 1:12925167-12925189 GAGGCAAGCGCTTGGAGGGAGGG + Intronic
902011867 1:13276596-13276618 GAGGCAAGCGCTTGGAGGGAGGG - Intergenic
904542043 1:31239740-31239762 GGGGCCAGCGCGCGGACGGACGG - Intergenic
907268047 1:53274759-53274781 GTGGCAAGCGCGTGGACGGCGGG - Intronic
907289814 1:53406596-53406618 ATGGCAGGAGCGTGGACTGCAGG - Intergenic
907409597 1:54274850-54274872 GTGGCAGGGGCCTGGACTGCAGG - Intronic
909609734 1:77539614-77539636 GTGACAAGAGCGGGGACTGCAGG + Intronic
914802894 1:150973898-150973920 GTGGCAAGTGGGTTGACTGCAGG - Intronic
1072294275 10:93994181-93994203 GCGACAGGCGCGCGGACGGCTGG + Intronic
1074459572 10:113624962-113624984 GTGGCAAGGGCGAGGTGGGCAGG + Intronic
1075769004 10:124917391-124917413 GTCGCAGGCGCGGGGAGGGCAGG + Intergenic
1076909607 10:133380305-133380327 TTGGCCAGCACGTGGCCGGCTGG + Exonic
1077365082 11:2158384-2158406 TGGGCAGGCGGGTGGACGGCCGG - Intronic
1077394344 11:2313753-2313775 GTGGTGAGCGTGGGGACGGCTGG + Exonic
1088640817 11:111871316-111871338 GCGGCAGGGGCGTGGCCGGCCGG - Intronic
1092525104 12:9305078-9305100 GGGAGAAGCGCGGGGACGGCAGG - Intergenic
1092542162 12:9426740-9426762 GGGAGAAGCGCGGGGACGGCAGG + Intergenic
1102555725 12:113725276-113725298 GAGGGAGGCGCGTGGAGGGCAGG + Intergenic
1119704656 14:76776279-76776301 GGGGCGAGGGCGTGGAAGGCGGG - Intronic
1136342958 16:29656875-29656897 GTGGCAAGGGCGTGGATGGCAGG + Intergenic
1136585111 16:31179698-31179720 GCGGCAAGAGGGTGGAGGGCAGG + Intergenic
1151729202 17:75901058-75901080 GTGGCAGGGCCGTGGTCGGCTGG - Intronic
1152122984 17:78430009-78430031 GTGGGAAGCGTGTGGTCGCCTGG - Intronic
1154322659 18:13367566-13367588 GTGCCAAGCGAGTGGACAGAGGG + Intronic
1157095091 18:44680168-44680190 GCGGGAAGCGCGGGGCCGGCCGG + Intronic
1160782998 19:886112-886134 GCGGCAAGCCCATGGAGGGCTGG - Exonic
1160809884 19:1008783-1008805 GTGGGGAGCGGGTGGGCGGCGGG + Intronic
1160900156 19:1423960-1423982 GTGTCAGGCGAGTGGAGGGCCGG + Intronic
1162057538 19:8073640-8073662 GTGTCAAGCGGGTGGAAGCCAGG - Intronic
926960543 2:18353892-18353914 CTGGCAAGCACGTGGATGGAGGG - Intronic
928705455 2:33945161-33945183 GTGGCAAGCGCCTGTACTCCTGG - Intergenic
931355650 2:61536635-61536657 GTGGGAAGCGAGGGGAGGGCGGG - Intronic
938243700 2:129761770-129761792 GTGACAAGAGGGTGCACGGCTGG - Intergenic
946529760 2:220558727-220558749 GCAACAAGCGGGTGGACGGCAGG - Intergenic
1169214835 20:3786806-3786828 GCGGGAAGCGCGGGGACGCCCGG + Intronic
1176194750 20:63831775-63831797 GCGTCAGGCGCGGGGACGGCCGG - Intergenic
1180956078 22:19741961-19741983 GTGCCAAGTGCTTGGAGGGCTGG - Intergenic
1184245136 22:43231927-43231949 GTGACCAGCGGGGGGACGGCAGG + Intronic
954662860 3:52235288-52235310 GTGGCAGGCGAGTGGCCTGCTGG + Intronic
959679108 3:109072435-109072457 GTGGCAGGTGCCTTGACGGCGGG - Intronic
963784827 3:149523721-149523743 GTGGCCAGCGCGTGGTCCACAGG + Intronic
1003221124 6:4161925-4161947 GTGGCCAGTGCGTGGACTGAAGG - Intergenic
1018614750 6:165676488-165676510 TTGGAAAGGGCGTGGTCGGCTGG + Intronic
1042703658 8:71644020-71644042 GTGGCTAGCATGTGGATGGCAGG + Intergenic
1049284791 8:141768761-141768783 GTGGAAAGCACGTGGAGGGAGGG + Intergenic
1049460860 8:142727118-142727140 GTGGCGCGGGCCTGGACGGCGGG + Intergenic
1049807527 8:144547687-144547709 GTGGCAGCGGCGTGGGCGGCTGG + Exonic
1062288511 9:135784415-135784437 GTGGCGAGCCCGTGGCCGGTGGG + Intronic
1062380966 9:136286288-136286310 GTGGCGAGCGTGGGGGCGGCAGG + Exonic
1197178977 X:123513911-123513933 GTGGGAAGCGGGTGGGAGGCAGG - Intergenic
1197842849 X:130768496-130768518 GTGGCAAGGTGGTGGACAGCAGG - Intronic
1200094386 X:153650370-153650392 GTGGCAAGGGAGGGGAGGGCAGG + Exonic
1200118589 X:153780119-153780141 GTGGCCAGCACGTGAAGGGCTGG + Intronic
1202589146 Y:26464421-26464443 GTGGCGAGCGCCTGTACGGGAGG - Intergenic