ID: 907268048

View in Genome Browser
Species Human (GRCh38)
Location 1:53274760-53274782
Sequence AGTGGCAAGCGCGTGGACGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907268048_907268055 9 Left 907268048 1:53274760-53274782 CCGCCGTCCACGCGCTTGCCACT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 907268055 1:53274792-53274814 AAATCTGCGGGGACCCTCACAGG 0: 1
1: 0
2: 0
3: 2
4: 59
907268048_907268061 27 Left 907268048 1:53274760-53274782 CCGCCGTCCACGCGCTTGCCACT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 907268061 1:53274810-53274832 ACAGGGTGACTCTGTTGGGCCGG 0: 1
1: 0
2: 1
3: 62
4: 570
907268048_907268053 -3 Left 907268048 1:53274760-53274782 CCGCCGTCCACGCGCTTGCCACT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 907268053 1:53274780-53274802 ACTCTTACACTGAAATCTGCGGG 0: 1
1: 0
2: 1
3: 16
4: 160
907268048_907268060 23 Left 907268048 1:53274760-53274782 CCGCCGTCCACGCGCTTGCCACT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 907268060 1:53274806-53274828 CCTCACAGGGTGACTCTGTTGGG 0: 1
1: 0
2: 0
3: 26
4: 311
907268048_907268054 -2 Left 907268048 1:53274760-53274782 CCGCCGTCCACGCGCTTGCCACT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 907268054 1:53274781-53274803 CTCTTACACTGAAATCTGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 224
907268048_907268058 22 Left 907268048 1:53274760-53274782 CCGCCGTCCACGCGCTTGCCACT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 907268058 1:53274805-53274827 CCCTCACAGGGTGACTCTGTTGG 0: 1
1: 0
2: 1
3: 17
4: 133
907268048_907268056 10 Left 907268048 1:53274760-53274782 CCGCCGTCCACGCGCTTGCCACT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG 0: 1
1: 0
2: 0
3: 4
4: 55
907268048_907268052 -4 Left 907268048 1:53274760-53274782 CCGCCGTCCACGCGCTTGCCACT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 907268052 1:53274779-53274801 CACTCTTACACTGAAATCTGCGG 0: 1
1: 0
2: 0
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907268048 Original CRISPR AGTGGCAAGCGCGTGGACGG CGG (reversed) Intronic
900213830 1:1470611-1470633 AATGGCAAGCGCTTGGACAAGGG + Intergenic
901973309 1:12925166-12925188 TGAGGCAAGCGCTTGGAGGGAGG + Intronic
902011868 1:13276597-13276619 TGAGGCAAGCGCTTGGAGGGAGG - Intergenic
905029154 1:34869927-34869949 AGTGGGAAGTGCTTGGACTGTGG - Intronic
907268048 1:53274760-53274782 AGTGGCAAGCGCGTGGACGGCGG - Intronic
912361678 1:109100647-109100669 AGGGGCGAGCACGTGAACGGCGG + Intergenic
919531080 1:198720953-198720975 AGTGGGAAGAGCGTGGAGGGAGG - Intronic
922740827 1:228013451-228013473 ACTGGCAAGTGCGTGGCCGCGGG + Intronic
1065108031 10:22410378-22410400 TGTGGTAAGCACGTGGATGGTGG + Intronic
1067527303 10:47046475-47046497 AGTGCCAAGCGAGGGGACTGCGG + Intergenic
1067782074 10:49215017-49215039 AGGGGGAAGCGAGTGGAGGGAGG + Intergenic
1073297553 10:102450404-102450426 AGAGCCAAGCGCGTGCACGCGGG + Exonic
1073578068 10:104641516-104641538 AGTGGCCAGCCAGTGGCCGGAGG + Exonic
1077322818 11:1949876-1949898 AGTGGCAGGGGCGGGAACGGGGG + Intronic
1202805836 11_KI270721v1_random:5189-5211 AGTGGCAGGGGCGGGAACGGGGG + Intergenic
1105847760 13:24308113-24308135 AATGGGGAGCGCGTGGCCGGTGG + Intronic
1112299504 13:98217360-98217382 AGTTGCAGGCGGGTGGACGATGG + Intronic
1121175702 14:91889270-91889292 AGTGGCCAGCGCCTGGCCAGAGG - Intronic
1122289225 14:100670801-100670823 AGTGGCAGGCGCGTGGGGAGTGG - Intergenic
1125930077 15:43593999-43594021 AGTGGCAGGCGGGCGGGCGGAGG - Intronic
1125943245 15:43693831-43693853 AGTGGCAGGCGGGCGGGCGGAGG - Exonic
1128151753 15:65367618-65367640 AGTGGCCAGCGGGTGGCGGGAGG - Intronic
1129080871 15:73039238-73039260 AGTGGCAACCACGTGGTTGGAGG + Intergenic
1132394143 15:101459770-101459792 GGTGGCAGGCGCATGGATGGAGG - Intronic
1132717729 16:1300647-1300669 ATTCCCATGCGCGTGGACGGTGG - Intergenic
1132796939 16:1729219-1729241 AGAGGCAAGCGCGGAGACGAGGG + Intronic
1136153736 16:28368426-28368448 CGCGGGACGCGCGTGGACGGCGG - Intergenic
1136209356 16:28746844-28746866 CGCGGGACGCGCGTGGACGGCGG + Intergenic
1142028573 16:87827265-87827287 AGTGGAAAGCCCCGGGACGGGGG + Intergenic
1142305186 16:89280662-89280684 AGAGGCAAGCGCCTGCTCGGAGG + Exonic
1145763195 17:27439603-27439625 CTTGGCAAGTGGGTGGACGGTGG - Intergenic
1154322658 18:13367565-13367587 AGTGCCAAGCGAGTGGACAGAGG + Intronic
1157601592 18:48896569-48896591 AGTGGCCAGAGCATGGACTGTGG - Intergenic
1162198506 19:9004220-9004242 AGTGGCAGCGGCGTGGGCGGGGG - Intergenic
1162805521 19:13136197-13136219 AGTGGCACGCGAGTGGCAGGAGG - Intronic
926960544 2:18353893-18353915 TCTGGCAAGCACGTGGATGGAGG - Intronic
927639396 2:24837111-24837133 AGTGACAAGGGCGTGGGAGGCGG + Intronic
927782473 2:25950795-25950817 AGTGGCAAGCACGTGAATAGAGG - Intronic
937321149 2:120961606-120961628 AGTAGCAAGCGCCTGGGCCGTGG - Intronic
948468322 2:238162656-238162678 AGTGGCAAGAGCTTGCACAGGGG + Intronic
948526701 2:238575121-238575143 AGAGACAAGCACGTGGAGGGAGG - Intergenic
1181023036 22:20113406-20113428 AGTGGCAAGGCCGTGGGTGGGGG - Intronic
1184860935 22:47173047-47173069 AGTGGGAAGCTCCTGGGCGGAGG + Intronic
956790661 3:72677591-72677613 AGAGGCCAGCGGGTGAACGGGGG - Intergenic
959679109 3:109072436-109072458 AGTGGCAGGTGCCTTGACGGCGG - Intronic
969182414 4:5452267-5452289 AGAGGCCAGCGAGTGGAGGGAGG + Intronic
972843181 4:42955480-42955502 AGTGGAAAGCACGTGGACTTTGG + Intronic
981064659 4:140469987-140470009 AGTGACAAGAGCCTGGAAGGCGG + Intronic
981641170 4:146945558-146945580 AGTGGCGAGGGCCTGGACTGAGG + Intronic
988949318 5:36241605-36241627 TGTGGCAGCCGCGCGGACGGCGG - Exonic
1001202653 5:169732349-169732371 AGTGGGAAGCGAGTGAAAGGAGG - Intronic
1007751100 6:44072614-44072636 ACTGGCAAGTGGGTGGCCGGGGG - Intergenic
1019414938 7:922815-922837 AGAGGCAGGTGCGTGGGCGGGGG - Intronic
1022066474 7:26864251-26864273 CGTGGGAAGCGCGGGGAGGGAGG + Intronic
1025021546 7:55484340-55484362 ACTGGCAAGGGGGTGGAAGGAGG - Intronic
1032216811 7:129963843-129963865 AGTGGCATGCGCTTTGACGTTGG - Intergenic
1036456504 8:8913528-8913550 AGTGGTAAGTGCATGGAGGGAGG - Intergenic
1049284790 8:141768760-141768782 TGTGGAAAGCACGTGGAGGGAGG + Intergenic
1049460859 8:142727117-142727139 AGTGGCGCGGGCCTGGACGGCGG + Intergenic
1049783361 8:144439036-144439058 AGTGGCTGGCGCATGGACAGAGG - Intronic
1057869703 9:98708664-98708686 AGTAGCAGGCGCGCGGGCGGCGG + Exonic
1062288510 9:135784414-135784436 GGTGGCGAGCCCGTGGCCGGTGG + Intronic
1062323636 9:136002603-136002625 AGTGGCAAGAGCCTGCACAGTGG - Intergenic
1200152990 X:153960343-153960365 AGTGGCCAGCCCGAGCACGGGGG + Exonic