ID: 907268049

View in Genome Browser
Species Human (GRCh38)
Location 1:53274763-53274785
Sequence AAGAGTGGCAAGCGCGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 79}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907268049_907268053 -6 Left 907268049 1:53274763-53274785 CCGTCCACGCGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 907268053 1:53274780-53274802 ACTCTTACACTGAAATCTGCGGG 0: 1
1: 0
2: 1
3: 16
4: 160
907268049_907268054 -5 Left 907268049 1:53274763-53274785 CCGTCCACGCGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 907268054 1:53274781-53274803 CTCTTACACTGAAATCTGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 224
907268049_907268060 20 Left 907268049 1:53274763-53274785 CCGTCCACGCGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 907268060 1:53274806-53274828 CCTCACAGGGTGACTCTGTTGGG 0: 1
1: 0
2: 0
3: 26
4: 311
907268049_907268055 6 Left 907268049 1:53274763-53274785 CCGTCCACGCGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 907268055 1:53274792-53274814 AAATCTGCGGGGACCCTCACAGG 0: 1
1: 0
2: 0
3: 2
4: 59
907268049_907268052 -7 Left 907268049 1:53274763-53274785 CCGTCCACGCGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 907268052 1:53274779-53274801 CACTCTTACACTGAAATCTGCGG 0: 1
1: 0
2: 0
3: 14
4: 155
907268049_907268058 19 Left 907268049 1:53274763-53274785 CCGTCCACGCGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 907268058 1:53274805-53274827 CCCTCACAGGGTGACTCTGTTGG 0: 1
1: 0
2: 1
3: 17
4: 133
907268049_907268056 7 Left 907268049 1:53274763-53274785 CCGTCCACGCGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG 0: 1
1: 0
2: 0
3: 4
4: 55
907268049_907268061 24 Left 907268049 1:53274763-53274785 CCGTCCACGCGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 907268061 1:53274810-53274832 ACAGGGTGACTCTGTTGGGCCGG 0: 1
1: 0
2: 1
3: 62
4: 570

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907268049 Original CRISPR AAGAGTGGCAAGCGCGTGGA CGG (reversed) Intronic
901653834 1:10757938-10757960 CAGAGTGGCCAGGACGTGGATGG - Intronic
905580535 1:39080859-39080881 AAGAGCGCCAAGGGCGGGGACGG + Intergenic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
906552663 1:46678594-46678616 AAGACTGGCCAGGACGTGGATGG - Exonic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
913663966 1:121030605-121030627 AAGAGTGGAAAGAGTGTGTAGGG + Intergenic
914015359 1:143813884-143813906 AAGAGTGGAAAGAGTGTGTAGGG + Intergenic
914162427 1:145147124-145147146 AAGAGTGGAAAGAGTGTGTAGGG - Intergenic
914653977 1:149722425-149722447 AAGAGTGGAAAGAGTGTGTAGGG + Intergenic
918132556 1:181642573-181642595 AAGAGTGGCAAGCACCAGAAAGG - Intronic
918163731 1:181924862-181924884 GAGAGTGGCAAAAGTGTGGAGGG - Intergenic
1069890063 10:71646992-71647014 GAGAGGGGCAGGCGCCTGGAGGG + Intronic
1076342541 10:129759617-129759639 AGGAGTGGCAAGCGGGCAGAGGG + Intronic
1076844884 10:133065251-133065273 AGGAGTGGCCAGCCCGAGGAGGG - Intergenic
1079274977 11:19027003-19027025 AAGTGTGGCAAGGAGGTGGAGGG + Intergenic
1089780384 11:120869612-120869634 AATAGTGGCAACCGTGTGGCAGG + Intronic
1090984645 11:131755336-131755358 AAGACTGGCAAGGGAGTGGAAGG + Intronic
1098283015 12:68880445-68880467 AAGAGTAACAAGCTCTTGGAGGG - Intronic
1098429567 12:70405005-70405027 AAGAGTGGCCAGAGGGTGAAAGG + Intronic
1101709174 12:107248980-107249002 AAGAGTGGTAAAGGCTTGGAGGG - Intergenic
1108088032 13:46816585-46816607 AAGAGTGGCATGGGTGAGGAGGG - Intergenic
1108948963 13:56063150-56063172 AAGAGTGGCTAGCAAGTAGAGGG + Intergenic
1109248881 13:59993803-59993825 ATGACTGGCAAGGGGGTGGAAGG - Intronic
1124021172 15:25925345-25925367 GAGAGTGGCATGCCCATGGAGGG + Intergenic
1124866710 15:33499305-33499327 AAGAGTGGCAGGAGGGAGGAGGG - Intronic
1128151754 15:65367621-65367643 GAGAGTGGCCAGCGGGTGGCGGG - Intronic
1135637431 16:24090519-24090541 AAGAGGGGCAAGGGAGTTGAGGG + Intronic
1136342957 16:29656871-29656893 CCGGGTGGCAAGGGCGTGGATGG + Intergenic
1136358753 16:29763964-29763986 ATGAGTGGCATGCGTGTGGCAGG - Intergenic
1146955225 17:36933355-36933377 AAGAGTGACAAGGCCGTGAAAGG - Intergenic
1148194266 17:45701909-45701931 AAGAGTGGGCAGAGTGTGGAAGG + Intergenic
1151264714 17:72945848-72945870 AACATTGGCAAGCCCTTGGATGG - Intronic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1156401759 18:36745760-36745782 ATGAGTGGCAGGTGCATGGAGGG - Intronic
1162805522 19:13136200-13136222 GAGAGTGGCACGCGAGTGGCAGG - Intronic
926326486 2:11788623-11788645 AAGAGGGGCAACCACGTGCAAGG - Intronic
937062719 2:118992342-118992364 ATGAGTGGGGAGCGGGTGGAGGG - Intronic
944457697 2:199911936-199911958 AAGGGCGCCAAGGGCGTGGAAGG - Intronic
1170946642 20:20896702-20896724 AGGAGTGGAAAGGGCATGGAGGG + Intergenic
1172271833 20:33659464-33659486 GAGAGGGGCAAGCGGCTGGATGG - Intronic
1174203950 20:48826341-48826363 AAAAGTGGCCAGCGGGTGGAGGG - Intronic
1179185995 21:39085725-39085747 AGGGGTGGCAAGGGCTTGGAGGG - Intergenic
1180204669 21:46251180-46251202 CAGAATGGCAAGAGCATGGATGG + Intronic
1180898076 22:19351887-19351909 AAGAGGGGCAACTGAGTGGAGGG + Intronic
1183218607 22:36497349-36497371 AAGAGGGGCAGGGGCATGGAGGG + Intronic
1183936956 22:41268052-41268074 AAGAGGGCCTTGCGCGTGGAGGG + Intronic
1184479521 22:44738425-44738447 ATGAGAGGCGAGCGCGTGGAAGG - Intronic
961797849 3:129422575-129422597 AAGAGTGCCCAGGGTGTGGATGG - Intronic
964429782 3:156593223-156593245 AAGAGTACCTAGTGCGTGGAAGG - Intergenic
965722603 3:171678069-171678091 CAGAGTGGGAAGGGCGGGGAGGG + Intronic
969122403 4:4919895-4919917 CAGAGTGGGAAGCTCTTGGAGGG + Intergenic
969182413 4:5452264-5452286 CAGAGAGGCCAGCGAGTGGAGGG + Intronic
970215204 4:13751808-13751830 AAGGATGGTAAGCGGGTGGATGG - Intergenic
971406501 4:26325407-26325429 AAGAGAGGCAACAGAGTGGAGGG + Intronic
984526631 4:180866243-180866265 CAGAGTGGCAAGGGGGTGGCGGG + Intergenic
984553044 4:181183207-181183229 AAGAGTGGCTTGCGCATAGAAGG - Intergenic
987825867 5:23029690-23029712 AAGAGGGGCAAGGGAGTTGAGGG - Intergenic
998216133 5:140239814-140239836 AAGAGAGGCAAGCCAGTGCAGGG + Intronic
999595726 5:153202064-153202086 AAGAGTGATAAGGGGGTGGATGG - Intergenic
1000652839 5:163838083-163838105 AAGTGTGCCAAGCGCAAGGATGG + Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1012971180 6:105732731-105732753 CAGACTAGCAGGCGCGTGGAAGG + Intergenic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1022776914 7:33536260-33536282 CAGAGTGGCAAGCGGGTCGTCGG - Intronic
1022892967 7:34719945-34719967 AAGTGTGGCATGGGCATGGAGGG - Intronic
1025021547 7:55484343-55484365 AAGACTGGCAAGGGGGTGGAAGG - Intronic
1025929804 7:65984411-65984433 AGGAGTGGCAAGATCCTGGAAGG - Intergenic
1026506043 7:70984862-70984884 AAGTGTGTCAAGCTAGTGGAGGG + Intergenic
1028516481 7:91682761-91682783 GAGAGTGGCAAGCCTGGGGAGGG + Intergenic
1037456088 8:19065679-19065701 AAGAGTGGCATGCCTGTGTAAGG - Intronic
1038340573 8:26682042-26682064 AGGAGTGGGAAGAGGGTGGAGGG - Intergenic
1047688605 8:127327749-127327771 AAGAGTAGCAAGCTCATGGCAGG - Intergenic
1058781161 9:108336946-108336968 GAAAGTGGCAAGGGAGTGGAGGG + Intergenic
1059184171 9:112251177-112251199 AAGAGTGGCAATCAGGTGTAAGG + Intronic
1186556790 X:10568554-10568576 AACAGTGACAAGCCCGTGGTGGG - Intronic
1189266630 X:39721724-39721746 AAGTGTGGCATGCGTTTGGAAGG - Intergenic
1189865590 X:45323805-45323827 AAGAGTGGGAAGGGTGGGGATGG - Intergenic
1192221017 X:69197386-69197408 AAGATTGGCAAGCAGGTTGATGG + Intergenic
1194112594 X:89853807-89853829 ATGAGAGGCAAGAGCGGGGAGGG + Intergenic
1197178978 X:123513915-123513937 AATAGTGGGAAGCGGGTGGGAGG - Intergenic
1199730124 X:150623503-150623525 AAGAGTGGCAGGCATGTTGAGGG + Intronic
1199833175 X:151563660-151563682 CAGAGTGCAAAGCGCGTGGTGGG - Exonic
1200465247 Y:3508619-3508641 ATGAGAGGCAAGAGCGGGGAGGG + Intergenic