ID: 907268050

View in Genome Browser
Species Human (GRCh38)
Location 1:53274767-53274789
Sequence GTGTAAGAGTGGCAAGCGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 33}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907268050_907268061 20 Left 907268050 1:53274767-53274789 CCACGCGCTTGCCACTCTTACAC 0: 1
1: 0
2: 0
3: 0
4: 33
Right 907268061 1:53274810-53274832 ACAGGGTGACTCTGTTGGGCCGG 0: 1
1: 0
2: 1
3: 62
4: 570
907268050_907268054 -9 Left 907268050 1:53274767-53274789 CCACGCGCTTGCCACTCTTACAC 0: 1
1: 0
2: 0
3: 0
4: 33
Right 907268054 1:53274781-53274803 CTCTTACACTGAAATCTGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 224
907268050_907268053 -10 Left 907268050 1:53274767-53274789 CCACGCGCTTGCCACTCTTACAC 0: 1
1: 0
2: 0
3: 0
4: 33
Right 907268053 1:53274780-53274802 ACTCTTACACTGAAATCTGCGGG 0: 1
1: 0
2: 1
3: 16
4: 160
907268050_907268058 15 Left 907268050 1:53274767-53274789 CCACGCGCTTGCCACTCTTACAC 0: 1
1: 0
2: 0
3: 0
4: 33
Right 907268058 1:53274805-53274827 CCCTCACAGGGTGACTCTGTTGG 0: 1
1: 0
2: 1
3: 17
4: 133
907268050_907268056 3 Left 907268050 1:53274767-53274789 CCACGCGCTTGCCACTCTTACAC 0: 1
1: 0
2: 0
3: 0
4: 33
Right 907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG 0: 1
1: 0
2: 0
3: 4
4: 55
907268050_907268055 2 Left 907268050 1:53274767-53274789 CCACGCGCTTGCCACTCTTACAC 0: 1
1: 0
2: 0
3: 0
4: 33
Right 907268055 1:53274792-53274814 AAATCTGCGGGGACCCTCACAGG 0: 1
1: 0
2: 0
3: 2
4: 59
907268050_907268060 16 Left 907268050 1:53274767-53274789 CCACGCGCTTGCCACTCTTACAC 0: 1
1: 0
2: 0
3: 0
4: 33
Right 907268060 1:53274806-53274828 CCTCACAGGGTGACTCTGTTGGG 0: 1
1: 0
2: 0
3: 26
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907268050 Original CRISPR GTGTAAGAGTGGCAAGCGCG TGG (reversed) Intronic
901656510 1:10772782-10772804 GAGTAAAAGTGGCCAGCGTGGGG - Intronic
906550670 1:46663880-46663902 GTGTAGGAGAGGCCAGCGCCAGG - Intronic
907268050 1:53274767-53274789 GTGTAAGAGTGGCAAGCGCGTGG - Intronic
917608017 1:176655684-176655706 GTGGAAGAGTAGAAAGCGGGTGG + Intronic
922442826 1:225670624-225670646 GTGGAAGAGTGGCAATAACGAGG - Intergenic
1075907019 10:126090208-126090230 GTGTAACAGTGGCAGGGGCTCGG + Intronic
1076981034 11:204923-204945 ATGTCAGAGTCCCAAGCGCGGGG + Exonic
1077423890 11:2465581-2465603 GTGTGAGAGGGGCCAGCACGGGG - Intronic
1085195903 11:74671573-74671595 GTGTGGGAGTGGCAAAGGCGAGG + Intergenic
1092069472 12:5621136-5621158 GTGGGAGTGTGGCGAGCGCGAGG - Intronic
1097178557 12:57157794-57157816 GTGTGAGTGTGGCAAGCCAGAGG + Intronic
1112433165 13:99370750-99370772 GTGGAGAAGTGGCAAGCGGGAGG - Intronic
1142560708 17:807388-807410 GTGGAAGAGAGGCAGGCACGGGG + Intronic
1147559002 17:41497562-41497584 GTGTGAGACTGGCATGGGCGTGG + Intergenic
1158599341 18:58843763-58843785 GTGGGAGAGTGGCAGGGGCGGGG - Intergenic
1163592711 19:18203483-18203505 GTGTGAGCGTTGCACGCGCGTGG - Intronic
1166231501 19:41427694-41427716 GTGTTAGAGTGACCAGGGCGAGG + Intronic
933141152 2:78793964-78793986 GTGTAGGACTGGCAAGCCCAGGG - Intergenic
935953418 2:108351520-108351542 GCTTAAGAGGGGCAAGCACGTGG - Intergenic
937118768 2:119427829-119427851 GTAAAAGAGTGGCAAGTGGGGGG + Intergenic
937675286 2:124583451-124583473 GTGTAACAGTGGGAAGGGCAGGG + Intronic
1174963796 20:55187736-55187758 GTGGAAGAATAGCAAGCGCAGGG + Intergenic
1184896023 22:47407096-47407118 GTATAACAGTGGCCAGGGCGTGG - Intergenic
954451047 3:50571918-50571940 GTGCAGGAGTGGCAAGAGTGGGG + Intronic
975965045 4:79963094-79963116 GTTTAAGAGTGCCAAGCACTGGG + Intronic
999101495 5:149029267-149029289 TTGTAAAAGTGGCAGGGGCGAGG + Intronic
1020411337 7:7895245-7895267 GGGTAAGAGAGGCAAGCCAGAGG - Intronic
1024326230 7:48111367-48111389 GTCAAAGAGTGGCCAGTGCGGGG - Intergenic
1027978139 7:85185216-85185238 GTGTAACCATGGCAACCGCGGGG - Intronic
1028977980 7:96935081-96935103 GTCTAAGAGGGGTAAGGGCGGGG - Intergenic
1033768135 7:144517271-144517293 GTGTATGAGTGGTAAGCACATGG + Intronic
1045569454 8:103354005-103354027 GTTTAAGAGTGGCAAGGCTGTGG - Intergenic
1050992605 9:12172365-12172387 GTGTAAGAGTGGGAAGACAGTGG + Intergenic
1055150911 9:72998111-72998133 GTGTAAGAGTGAGAAGAGAGGGG + Intronic