ID: 907268051

View in Genome Browser
Species Human (GRCh38)
Location 1:53274778-53274800
Sequence CGCAGATTTCAGTGTAAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907268051_907268060 5 Left 907268051 1:53274778-53274800 CCACTCTTACACTGAAATCTGCG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 907268060 1:53274806-53274828 CCTCACAGGGTGACTCTGTTGGG 0: 1
1: 0
2: 0
3: 26
4: 311
907268051_907268061 9 Left 907268051 1:53274778-53274800 CCACTCTTACACTGAAATCTGCG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 907268061 1:53274810-53274832 ACAGGGTGACTCTGTTGGGCCGG 0: 1
1: 0
2: 1
3: 62
4: 570
907268051_907268055 -9 Left 907268051 1:53274778-53274800 CCACTCTTACACTGAAATCTGCG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 907268055 1:53274792-53274814 AAATCTGCGGGGACCCTCACAGG 0: 1
1: 0
2: 0
3: 2
4: 59
907268051_907268062 21 Left 907268051 1:53274778-53274800 CCACTCTTACACTGAAATCTGCG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 907268062 1:53274822-53274844 TGTTGGGCCGGACAAGAGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 93
907268051_907268056 -8 Left 907268051 1:53274778-53274800 CCACTCTTACACTGAAATCTGCG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG 0: 1
1: 0
2: 0
3: 4
4: 55
907268051_907268058 4 Left 907268051 1:53274778-53274800 CCACTCTTACACTGAAATCTGCG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 907268058 1:53274805-53274827 CCCTCACAGGGTGACTCTGTTGG 0: 1
1: 0
2: 1
3: 17
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907268051 Original CRISPR CGCAGATTTCAGTGTAAGAG TGG (reversed) Intronic
906349328 1:45044244-45044266 TGCAGATATCAGTGTAATAAAGG - Intronic
906726227 1:48046540-48046562 CTCAAAATTCAGTGTAAGAATGG - Intergenic
907268051 1:53274778-53274800 CGCAGATTTCAGTGTAAGAGTGG - Intronic
907815663 1:57916156-57916178 CCCAGATTTCACTGTCAGGGAGG - Intronic
912763692 1:112390085-112390107 CTGAGATTTTAGTGTAAGAAAGG - Intergenic
916900704 1:169219455-169219477 CGCAGATTTTGGTGTCTGAGGGG + Intronic
924559702 1:245147503-245147525 AGCAAGTTTCAGTGTCAGAGAGG - Intergenic
1063824450 10:9878431-9878453 GGCAAGTTTCAGAGTAAGAGTGG - Intergenic
1075816342 10:125267315-125267337 GGCAGAGTTCAGGGTAGGAGGGG - Intergenic
1078125848 11:8562467-8562489 TGCAGATTTCACTGAAAGTGGGG - Intronic
1080199716 11:29654768-29654790 GCCAGATTTCAGTGCAAAAGAGG - Intergenic
1081159024 11:39731339-39731361 GGCAAGTTTCAGAGTAAGAGTGG + Intergenic
1089478857 11:118789820-118789842 TGCAGGTTTCAGTTTAAGAAGGG - Intronic
1092981420 12:13798605-13798627 GGCAGATTACAATATAAGAGAGG - Intronic
1095095123 12:38143185-38143207 CTCAGTTTTCAGAGTAACAGTGG - Intergenic
1096588097 12:52636992-52637014 AGCAGGTTTCAGGGGAAGAGAGG + Intergenic
1100912525 12:99381642-99381664 CTGAGACTTCAGTGCAAGAGTGG + Intronic
1108738552 13:53310826-53310848 TGCAGATTTCTGTGTCAAAGTGG - Intergenic
1114379607 14:22187583-22187605 AGAAAATTTCAGTGTAACAGTGG - Intergenic
1115386353 14:32802529-32802551 GACAAATTTCAGTGTTAGAGAGG + Intronic
1119383120 14:74240952-74240974 AACAGATTTCGTTGTAAGAGAGG - Intronic
1120513804 14:85446464-85446486 GGAAGATTTCACTGTAAAAGGGG - Intergenic
1120964171 14:90152971-90152993 GGCAGAGTTGAGTGTCAGAGGGG - Intronic
1121857879 14:97287015-97287037 CACAGCTTGCAGTGTAAGAATGG + Intergenic
1202888551 14_KI270722v1_random:132557-132579 CTCAGATTTCTGTTTGAGAGTGG + Intergenic
1124783447 15:32657604-32657626 AGCAGATGTCAGTGGAAGAAAGG + Intronic
1135059031 16:19255302-19255324 CCCAAATATCAGTGTAAGTGTGG - Intronic
1140927992 16:79600977-79600999 CGCAAAGTTTGGTGTAAGAGGGG + Intergenic
1142311169 16:89314829-89314851 CGCAGGTTTTAGGGTAAGGGTGG - Intronic
1143425474 17:6832576-6832598 TGCAGATTTCAGTATCTGAGGGG - Intergenic
1157446462 18:47749821-47749843 CGCAGTTTTCAGGGTAAGTTTGG + Intergenic
1160303075 18:77704185-77704207 CGCAGTTTTAAGTGTCAAAGTGG - Intergenic
1163366217 19:16877471-16877493 CTCAGAGTCCAGAGTAAGAGTGG + Intronic
1167793339 19:51693721-51693743 CACTGATTTCGGTGTCAGAGAGG - Intergenic
1202663947 1_KI270708v1_random:99350-99372 CTCAGATTTCTGTTTGAGAGTGG + Intergenic
926302956 2:11617547-11617569 GGCAGATTTCAGGGTAGGTGAGG + Intronic
926405823 2:12551665-12551687 AGCAGATTTCACAGTGAGAGGGG - Intergenic
927256044 2:21042048-21042070 TGTAGATTTCAGCGTGAGAGAGG - Intronic
930643947 2:53883841-53883863 AGCAGAGTTCAGTGGAATAGTGG - Intronic
932990803 2:76783847-76783869 TGCACATTTCAGAGTAAGATGGG + Intronic
934483264 2:94673952-94673974 TGCAGATTTCAATGTCTGAGAGG - Intergenic
937958295 2:127436020-127436042 GGCAGAATTGAGTGTAAGAGAGG + Intergenic
944066091 2:195620403-195620425 CCCAGAGTTCAGAGAAAGAGAGG + Intronic
947810803 2:233002946-233002968 CGCTGAGGTCAGTGTAAGAAGGG - Intronic
1173780080 20:45748639-45748661 ATGAGATTTCAGTATAAGAGTGG + Intronic
1175753725 20:61516185-61516207 CGCAGCTTCTAGGGTAAGAGAGG - Intronic
1178326418 21:31649172-31649194 CACAGAAATCAGTGAAAGAGGGG + Intergenic
1180330676 22:11476234-11476256 CTCAGATTTCTGTTTGAGAGTGG + Intergenic
1182958696 22:34451973-34451995 AACAGACTTCAGAGTAAGAGAGG - Intergenic
949436461 3:4034903-4034925 AGCAGATTACGGTGTAAGATTGG + Intronic
951870224 3:27353747-27353769 AGCAGTTTTCAGTCTGAGAGTGG - Intronic
953965877 3:47306374-47306396 TGCAAATATCATTGTAAGAGAGG + Intronic
957092009 3:75740266-75740288 CTCAGATTTCTGTTTGAGAGTGG - Intronic
959314397 3:104784278-104784300 CATATATTTCAGTGTATGAGTGG - Intergenic
962342002 3:134593695-134593717 GACAGATTTCAGTCTAACAGGGG + Intergenic
963856237 3:150256781-150256803 AGCAGCTTTTAATGTAAGAGTGG + Intergenic
964217349 3:154301083-154301105 CACAGATCCCAGTTTAAGAGGGG - Exonic
972137793 4:35914058-35914080 ATCAGATTTCAGTGGAAGAGAGG + Intergenic
975532496 4:75415185-75415207 CTCAATTTTCAGTGTTAGAGGGG - Intergenic
977238438 4:94537229-94537251 GGCAGACTTGACTGTAAGAGAGG - Intronic
982171206 4:152663307-152663329 GGCATATTTCAGGGTAAAAGAGG + Intronic
989426541 5:41302577-41302599 TACAGAGTTCTGTGTAAGAGTGG - Intergenic
989547423 5:42690684-42690706 CCCACCTTTCAGTATAAGAGAGG + Intronic
993424309 5:87743539-87743561 TGCAGCCTTCAGTGTAAAAGCGG + Intergenic
993622263 5:90182381-90182403 CGGAGATTTCTGAGCAAGAGAGG - Intergenic
998824268 5:146084906-146084928 CTAAAATTTCAGTGTAAGAAGGG + Intronic
1004555272 6:16690905-16690927 CCCAGATTTCATTTTAGGAGAGG + Intronic
1007180752 6:39927533-39927555 CACAGATGTCAGAGTAAGGGAGG - Exonic
1009561434 6:65249968-65249990 TGCAGAAATCCGTGTAAGAGAGG + Intronic
1016171148 6:141018579-141018601 AGACGATTTCAGTGTTAGAGAGG - Intergenic
1018559215 6:165084050-165084072 CGCAAATTTCAGAGCAGGAGTGG - Intergenic
1023309564 7:38870196-38870218 CTAAGATATCAGTGGAAGAGAGG + Intronic
1024736211 7:52307693-52307715 GGCAGCTTTCAGTGGATGAGTGG + Intergenic
1039407130 8:37322978-37323000 CAGAGATTACATTGTAAGAGAGG + Intergenic
1039786058 8:40835009-40835031 CGCAGATGTCAGGGAAAGCGTGG + Intronic
1040279908 8:46034888-46034910 CTCAGGTTTCAGAGTAACAGTGG + Intergenic
1045211058 8:100100103-100100125 CCCAGATTTCAGTGTCTGTGGGG - Intronic
1050691617 9:8233782-8233804 AGAAGATTACAGTGTAATAGTGG - Intergenic
1056065249 9:82926788-82926810 AGCATATTTCAGTATAGGAGTGG - Intergenic
1058727972 9:107821706-107821728 TGCAAATTTCAGAGTAAGTGTGG - Intergenic
1059357203 9:113709111-113709133 CGCAGATTTCACAGAAAGACTGG - Intergenic
1203485744 Un_GL000224v1:52477-52499 CTCAGATTTCTGTTTGAGAGTGG + Intergenic
1192038000 X:67586754-67586776 TGTTGAGTTCAGTGTAAGAGTGG + Intronic
1192747151 X:73950514-73950536 TGCAGATTTGACTGTATGAGGGG - Intergenic
1193326005 X:80179226-80179248 CCCAGACTTCAGTGCAAAAGTGG + Intergenic
1197805973 X:130399024-130399046 GGCAGATTTCAGTGAGAGAGAGG + Intergenic
1199235380 X:145486997-145487019 CAGAGATTACATTGTAAGAGAGG + Intergenic