ID: 907268052

View in Genome Browser
Species Human (GRCh38)
Location 1:53274779-53274801
Sequence CACTCTTACACTGAAATCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 155}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907268044_907268052 27 Left 907268044 1:53274729-53274751 CCGGCAGTCCCTCTGCACATCAC 0: 1
1: 0
2: 1
3: 27
4: 250
Right 907268052 1:53274779-53274801 CACTCTTACACTGAAATCTGCGG 0: 1
1: 0
2: 0
3: 14
4: 155
907268047_907268052 -3 Left 907268047 1:53274759-53274781 CCCGCCGTCCACGCGCTTGCCAC 0: 1
1: 0
2: 1
3: 0
4: 53
Right 907268052 1:53274779-53274801 CACTCTTACACTGAAATCTGCGG 0: 1
1: 0
2: 0
3: 14
4: 155
907268043_907268052 28 Left 907268043 1:53274728-53274750 CCCGGCAGTCCCTCTGCACATCA 0: 1
1: 0
2: 1
3: 18
4: 208
Right 907268052 1:53274779-53274801 CACTCTTACACTGAAATCTGCGG 0: 1
1: 0
2: 0
3: 14
4: 155
907268046_907268052 18 Left 907268046 1:53274738-53274760 CCTCTGCACATCACACACTTTCC 0: 1
1: 0
2: 3
3: 29
4: 311
Right 907268052 1:53274779-53274801 CACTCTTACACTGAAATCTGCGG 0: 1
1: 0
2: 0
3: 14
4: 155
907268048_907268052 -4 Left 907268048 1:53274760-53274782 CCGCCGTCCACGCGCTTGCCACT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 907268052 1:53274779-53274801 CACTCTTACACTGAAATCTGCGG 0: 1
1: 0
2: 0
3: 14
4: 155
907268045_907268052 19 Left 907268045 1:53274737-53274759 CCCTCTGCACATCACACACTTTC 0: 1
1: 0
2: 0
3: 25
4: 307
Right 907268052 1:53274779-53274801 CACTCTTACACTGAAATCTGCGG 0: 1
1: 0
2: 0
3: 14
4: 155
907268049_907268052 -7 Left 907268049 1:53274763-53274785 CCGTCCACGCGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 907268052 1:53274779-53274801 CACTCTTACACTGAAATCTGCGG 0: 1
1: 0
2: 0
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907268052 Original CRISPR CACTCTTACACTGAAATCTG CGG Intronic
904710290 1:32425158-32425180 CACTGTTACAGTTAAACCTGTGG - Intergenic
907268052 1:53274779-53274801 CACTCTTACACTGAAATCTGCGG + Intronic
907389215 1:54146149-54146171 CACTCTTACACTGAAAATATTGG - Intronic
908302733 1:62778334-62778356 AGCTCTTACACTGAAAGGTGGGG - Intergenic
909483713 1:76151739-76151761 CACTGTTACAATGAAGGCTGAGG + Intronic
910633400 1:89380818-89380840 AACTCTGTCACTGATATCTGTGG + Intronic
912830233 1:112946211-112946233 CACTCTTTCACTGCATTTTGTGG + Intronic
915558506 1:156673445-156673467 TCCTCTTACCCTGAAAGCTGAGG + Exonic
917089672 1:171340267-171340289 CACTGTTTCACTGAAATGTTTGG + Intronic
921109641 1:212022173-212022195 AGCTCTTACACTGAGGTCTGTGG - Intronic
921441759 1:215195944-215195966 GAGTCTGACACTGATATCTGTGG - Intronic
921709748 1:218361986-218362008 CACTCTTTAACTGAGATATGGGG - Intronic
923535544 1:234848420-234848442 CACTATTACCCTGACTTCTGAGG + Intergenic
923612484 1:235507040-235507062 CACTCTAACCTTGAACTCTGGGG - Intergenic
924760179 1:246977110-246977132 CGCTCTTACATTTATATCTGGGG - Intronic
1066444745 10:35471497-35471519 CACTGTTACTGTGACATCTGTGG + Intronic
1067300719 10:45006316-45006338 CAAATCTACACTGAAATCTGTGG - Intergenic
1067395892 10:45916996-45917018 CACTATTACAGAGAAAACTGAGG + Intergenic
1067864215 10:49886121-49886143 CACTATTACAGAGAAAACTGAGG + Intronic
1067896442 10:50185621-50185643 AACTTTTACACTGAAGACTGTGG + Exonic
1067952532 10:50756406-50756428 AACTTTTACACTGAAGACTGTGG - Intronic
1068114369 10:52720807-52720829 GACTTTTTCACTAAAATCTGGGG + Intergenic
1068122893 10:52802203-52802225 CACTCTGACAGGGAAATCTTTGG - Intergenic
1072008216 10:91277391-91277413 CTCTCTTAAAATGAAATTTGAGG - Intronic
1074346947 10:112695610-112695632 CCTTCTTACACTGGAATCTCTGG + Intronic
1074847645 10:117412449-117412471 CAGTCTTTCACTGACATCAGGGG + Intergenic
1075274811 10:121083882-121083904 CACTTTTACCCTGAATTGTGTGG + Intergenic
1084863580 11:72038641-72038663 CACCCTCCCCCTGAAATCTGAGG + Intronic
1085849690 11:80105659-80105681 CACTCTCAGACTGAGATGTGAGG + Intergenic
1087027436 11:93663310-93663332 TAGACTTACACTGAAGTCTGAGG + Intronic
1088916135 11:114229045-114229067 CACACTCACACAGAAAACTGTGG + Intronic
1090424874 11:126600588-126600610 CACTCCAACACTCAAATCTATGG + Intronic
1090480728 11:127065806-127065828 CACTCTTAAACAGAAATGAGGGG + Intergenic
1093153756 12:15655396-15655418 CACTATTACACTGTAATTTATGG + Intronic
1094047063 12:26178976-26178998 CCCTCCTACACTGTAAGCTGTGG - Intronic
1094819608 12:34214292-34214314 AACTGTTACTCTGAAAACTGAGG - Intergenic
1095084710 12:38048919-38048941 CACTGTTACTCTGAAAACTGAGG - Intergenic
1095095124 12:38143186-38143208 CACTGTTACTCTGAAAACTGAGG + Intergenic
1095342548 12:41108580-41108602 AAATCTTATACTGAAATCTGAGG - Intergenic
1097285922 12:57877233-57877255 GACTTTTAAACTAAAATCTGAGG + Intergenic
1098760236 12:74414980-74415002 CACTGTTACAATTAAATATGAGG - Intergenic
1100710888 12:97255711-97255733 CAGTGTTGCAATGAAATCTGAGG + Intergenic
1104078865 12:125412906-125412928 CATTCTTCCGCTGAATTCTGGGG - Intronic
1104220632 12:126781424-126781446 TACTCTTACAGGGAAATCAGAGG + Intergenic
1104629138 12:130385735-130385757 GACATTTGCACTGAAATCTGTGG + Intergenic
1106146572 13:27054654-27054676 CATTCTCACAGTGAAATTTGAGG - Intergenic
1107698137 13:43020894-43020916 TCCTTTTACACTGAAATCTGTGG - Intergenic
1109350167 13:61169849-61169871 CACTCTTACACTTCAAACTGTGG - Intergenic
1110021954 13:70485624-70485646 CTCTATCACACTGAAATATGGGG - Intergenic
1113917623 13:113883906-113883928 CACTCTTGCAGGAAAATCTGGGG - Intergenic
1114799653 14:25759331-25759353 AACTCTTTCTCTGAAATATGGGG + Intergenic
1114969359 14:28005996-28006018 CACTCCTACACCCAACTCTGTGG + Intergenic
1117223734 14:53633823-53633845 CATTATTACATTGAAACCTGTGG + Intergenic
1119944950 14:78683626-78683648 CACTAATACAGTGCAATCTGCGG - Intronic
1120281896 14:82449907-82449929 CACACATACACTGTGATCTGAGG + Intergenic
1120708668 14:87771289-87771311 CACTGTTACTCTGAAAACGGAGG - Intergenic
1126592841 15:50356897-50356919 CACTGTTACACAAAAATTTGAGG + Intergenic
1126668852 15:51097789-51097811 CACTAAAACAGTGAAATCTGAGG + Intronic
1126797907 15:52275260-52275282 CACTGGTACACTGAAATCACTGG - Intronic
1130567865 15:85013004-85013026 CACAGTTAAACAGAAATCTGGGG + Intronic
1133472545 16:6089512-6089534 AAATCTTAGACTAAAATCTGTGG + Intronic
1135059033 16:19255303-19255325 CACACTTACACTGATATTTGGGG + Intronic
1137343393 16:47632285-47632307 ACCTTTTACACTGAAATCTCTGG - Intronic
1137906798 16:52331606-52331628 CACTCATCTACTGAGATCTGGGG - Intergenic
1138793562 16:59939559-59939581 CAATCTTACAATAAAATCTCAGG + Intergenic
1139741285 16:69037254-69037276 CAGCCTTACACTGAGAGCTGAGG + Intronic
1142311170 16:89314830-89314852 CACCCTTACCCTAAAACCTGCGG + Intronic
1147299634 17:39515598-39515620 AACTCAGACACTGAAATTTGGGG + Intronic
1150222669 17:63506109-63506131 TACTCTTGCACTGAGGTCTGTGG - Intronic
1151201383 17:72470242-72470264 CATTCTCACACTGAAGTCAGGGG + Intergenic
1157092078 18:44648531-44648553 GACTCTTACACTGGGTTCTGAGG + Intergenic
1157110395 18:44815265-44815287 CAGTCTTACATTAAAATGTGTGG + Intronic
1157446461 18:47749820-47749842 CAAACTTACCCTGAAAACTGCGG - Intergenic
1160069891 18:75619022-75619044 CACTATTCCACTAAAATTTGAGG - Intergenic
925945997 2:8864550-8864572 CCCTCTCACACTGAAAACTGGGG + Intronic
928725308 2:34165838-34165860 CCTTCTAACACTGAAGTCTGTGG + Intergenic
929605656 2:43232533-43232555 CACTCTTAGGCTGACTTCTGGGG - Intronic
930833079 2:55766069-55766091 CACTCTCACACTCTTATCTGTGG - Intergenic
935396541 2:102615918-102615940 GACTATTACACTGGTATCTGAGG + Intergenic
940440071 2:153704516-153704538 CACTCTTGCATTGAAAACTGAGG - Intergenic
941538089 2:166745778-166745800 AACACTTACAGTGATATCTGCGG + Intergenic
942669729 2:178361987-178362009 CACTCTTACCTTGAAATTTTGGG - Intronic
943037045 2:182760105-182760127 CTCTGTTACACTGGAATCTAAGG - Intronic
944066089 2:195620402-195620424 CTCTCTTTCTCTGAACTCTGGGG - Intronic
945432747 2:209783673-209783695 CTCTCTTATACTGAAATCCTGGG - Intronic
945468895 2:210204086-210204108 CCCCCTTACACTGGCATCTGAGG + Intronic
948451117 2:238072994-238073016 AGCTCTTACATTTAAATCTGTGG + Intronic
1170762734 20:19265115-19265137 CACTACTACAATGACATCTGAGG + Intronic
1173188351 20:40858166-40858188 CCCTTTTACACAGAGATCTGAGG + Intergenic
1173219878 20:41123601-41123623 CACTGTTTCACTGAAATGTTTGG + Exonic
1176554054 21:8245398-8245420 CACTGTTACTCTGAAAACGGAGG + Intergenic
1176572976 21:8428422-8428444 CACTGTTACTCTGAAAACGGAGG + Intergenic
1181719839 22:24765166-24765188 CACTGTTTCACTGAAATGTTTGG + Intronic
1183800933 22:40164043-40164065 CACACTCACTTTGAAATCTGAGG + Intronic
1184636436 22:45835676-45835698 CACCCCTGCACTGAAAGCTGAGG - Intronic
1203259059 22_KI270733v1_random:162436-162458 CACTGTTACTCTGAAAACGGAGG + Intergenic
951714801 3:25629385-25629407 CATTCTTTTAGTGAAATCTGGGG - Intronic
951776377 3:26314798-26314820 CACACACACACAGAAATCTGCGG - Intergenic
952022714 3:29042073-29042095 CACTCTCCCACAGAAAGCTGAGG + Intergenic
952034538 3:29183617-29183639 TACTATTACACAGATATCTGAGG + Intergenic
955375032 3:58387581-58387603 CATTCCTACACGGAGATCTGAGG + Intronic
959280091 3:104326371-104326393 CAATGTTACATTGAAATATGAGG - Intergenic
959755744 3:109896705-109896727 GACTCTTACACTGCTGTCTGGGG - Intergenic
960241646 3:115349460-115349482 CAATCTCATGCTGAAATCTGAGG + Intergenic
965604595 3:170485737-170485759 CTCTCTTCCCCTTAAATCTGGGG - Intronic
967826373 3:193880878-193880900 CACACTTTCACTGAAAAATGAGG - Intergenic
970939668 4:21616592-21616614 CAAACTTTCTCTGAAATCTGTGG + Intronic
970973693 4:22017048-22017070 CTCTTTTACATTAAAATCTGTGG - Intergenic
973798053 4:54448931-54448953 CACCCTCACACTAAATTCTGAGG + Intergenic
975659257 4:76672055-76672077 CACTCTTTCCCTTAAATGTGGGG - Intronic
976608272 4:87002787-87002809 GATTCTTAACCTGAAATCTGCGG + Intronic
977034415 4:91931789-91931811 TACTCTGACACTGAAAATTGAGG - Intergenic
977433026 4:96956607-96956629 CAATCTGACAGTGAAAGCTGAGG - Intergenic
977899808 4:102407010-102407032 CACACTTACATTGGAATCTGTGG - Intronic
979721093 4:123901354-123901376 CACTCTTTCACAGGATTCTGTGG - Intergenic
981220469 4:142226862-142226884 CACTCCTACACTGAACTGTTGGG + Intronic
981957019 4:150489819-150489841 CACTATTATACTGAATTCAGGGG + Intronic
982869243 4:160555292-160555314 GAATCTTACACTGAAAACTATGG + Intergenic
982997501 4:162368063-162368085 CACCTCTGCACTGAAATCTGTGG - Intergenic
983091956 4:163514597-163514619 AACTTTTAGACTGACATCTGAGG - Intronic
988556624 5:32241883-32241905 AACTCTAACACTGAAATCCAAGG + Intronic
988956565 5:36325857-36325879 CACTATTACAGTGAAAGGTGAGG - Intergenic
989251938 5:39327278-39327300 TATTTTTACACTGAAATGTGGGG + Intronic
989260589 5:39415564-39415586 GATTGTTTCACTGAAATCTGAGG - Intronic
989547421 5:42690683-42690705 CTCTCTTATACTGAAAGGTGGGG - Intronic
990839179 5:60056475-60056497 CTCTCTTCCACTTAAATTTGCGG - Intronic
997877086 5:137559160-137559182 CTCTCTGATACTGAAAGCTGGGG + Intronic
998824266 5:146084905-146084927 CCTTCTTACACTGAAATTTTAGG - Intronic
999469699 5:151842638-151842660 CAGTTTTTCACTGAAAACTGAGG - Intronic
1004555270 6:16690904-16690926 CTCTCCTAAAATGAAATCTGGGG - Intronic
1008276865 6:49552048-49552070 CTTTCTAACACTGAAATGTGGGG - Exonic
1011622117 6:89252789-89252811 AACTATTACACTGGAATTTGGGG - Intergenic
1016384119 6:143514359-143514381 CACTCTTTAACTGAAATATATGG - Intergenic
1016493774 6:144636026-144636048 CACTATTACACTCAATTCTAGGG - Intronic
1018086566 6:160306314-160306336 AACTCACACACTGATATCTGTGG + Intergenic
1018819073 6:167358753-167358775 CACCCTTTCTCTGAGATCTGAGG - Intronic
1019470419 7:1217225-1217247 CATTCTTAAACTGGAATCTTTGG + Intergenic
1021561639 7:21973490-21973512 CACACACACACTGACATCTGTGG + Intergenic
1022817820 7:33930305-33930327 AACTCTTACACAGAAATATCTGG - Intronic
1027682826 7:81241462-81241484 CAGTTTTACACAGAAAGCTGAGG - Intergenic
1028031851 7:85925741-85925763 CACTTTTCCAGTGATATCTGTGG - Intergenic
1031731279 7:125303913-125303935 CACTCTTACACATAAATTTGGGG - Intergenic
1032732154 7:134654359-134654381 CACTGTCACATTGAAACCTGAGG - Intronic
1036411607 8:8506752-8506774 CACTCTGCCACTGAAATGGGAGG - Intergenic
1040279907 8:46034887-46034909 CACTGTTACTCTGAAACCTGAGG - Intergenic
1040896775 8:52376213-52376235 CACTCTTACAGTGACCTCTAAGG + Intronic
1041289740 8:56297424-56297446 CACTCTTTCAGTACAATCTGTGG - Intergenic
1041828860 8:62129555-62129577 AACTCTTACACTGCAAACTATGG - Intergenic
1042365586 8:67933048-67933070 CACTTTTACACTGAAAAAAGAGG - Intergenic
1043828298 8:84956093-84956115 CACACTTTCATTGAAGTCTGAGG + Intergenic
1045211061 8:100100104-100100126 CCCACAGACACTGAAATCTGGGG + Intronic
1048130491 8:131691629-131691651 GACTCTTATACTGAAATATGAGG + Intergenic
1050620111 9:7443136-7443158 AACTCTTACACTTAAATCTTTGG + Intergenic
1051521263 9:17991740-17991762 CAGTCTAACCGTGAAATCTGAGG - Intergenic
1052677209 9:31642142-31642164 CACTCTTACAGGGAACTCAGAGG + Intergenic
1053006116 9:34605771-34605793 CACACTCCCTCTGAAATCTGTGG - Intergenic
1058526731 9:105866489-105866511 GCCTCTAACAGTGAAATCTGTGG - Intergenic
1060138946 9:121187590-121187612 AACTTTTTCACTGATATCTGGGG - Intronic
1060800790 9:126544734-126544756 CACTCTTGCACACAAAGCTGGGG + Intergenic
1203475250 Un_GL000220v1:144445-144467 CACTGTTACTCTGAAAACGGAGG + Intergenic
1188735379 X:33707183-33707205 ACCTCTTACACTAAAATTTGTGG - Intergenic
1193326003 X:80179225-80179247 CACTTTTGCACTGAAGTCTGGGG - Intergenic
1193851893 X:86547083-86547105 CACTCTTATACTAAAAACAGGGG - Intronic
1197201974 X:123756180-123756202 CACTCTCACAGTCAAACCTGGGG - Intergenic
1197532844 X:127651716-127651738 TACTTTTACACTGCAGTCTGAGG - Intergenic
1198046778 X:132911581-132911603 CACATTTAAACTGAAATCTAAGG - Intronic
1198631467 X:138643686-138643708 CACTGTTTAACAGAAATCTGTGG + Intronic
1201594694 Y:15654737-15654759 CACTCTCACACTGATGTTTGAGG - Intergenic
1201774829 Y:17651005-17651027 GACACTTACTCTGAAAACTGAGG + Intergenic
1201826727 Y:18254984-18255006 GACACTTACTCTGAAAACTGAGG - Intergenic