ID: 907268053

View in Genome Browser
Species Human (GRCh38)
Location 1:53274780-53274802
Sequence ACTCTTACACTGAAATCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 160}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907268048_907268053 -3 Left 907268048 1:53274760-53274782 CCGCCGTCCACGCGCTTGCCACT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 907268053 1:53274780-53274802 ACTCTTACACTGAAATCTGCGGG 0: 1
1: 0
2: 1
3: 16
4: 160
907268047_907268053 -2 Left 907268047 1:53274759-53274781 CCCGCCGTCCACGCGCTTGCCAC 0: 1
1: 0
2: 1
3: 0
4: 53
Right 907268053 1:53274780-53274802 ACTCTTACACTGAAATCTGCGGG 0: 1
1: 0
2: 1
3: 16
4: 160
907268050_907268053 -10 Left 907268050 1:53274767-53274789 CCACGCGCTTGCCACTCTTACAC 0: 1
1: 0
2: 0
3: 0
4: 33
Right 907268053 1:53274780-53274802 ACTCTTACACTGAAATCTGCGGG 0: 1
1: 0
2: 1
3: 16
4: 160
907268044_907268053 28 Left 907268044 1:53274729-53274751 CCGGCAGTCCCTCTGCACATCAC 0: 1
1: 0
2: 1
3: 27
4: 250
Right 907268053 1:53274780-53274802 ACTCTTACACTGAAATCTGCGGG 0: 1
1: 0
2: 1
3: 16
4: 160
907268049_907268053 -6 Left 907268049 1:53274763-53274785 CCGTCCACGCGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 907268053 1:53274780-53274802 ACTCTTACACTGAAATCTGCGGG 0: 1
1: 0
2: 1
3: 16
4: 160
907268046_907268053 19 Left 907268046 1:53274738-53274760 CCTCTGCACATCACACACTTTCC 0: 1
1: 0
2: 3
3: 29
4: 311
Right 907268053 1:53274780-53274802 ACTCTTACACTGAAATCTGCGGG 0: 1
1: 0
2: 1
3: 16
4: 160
907268043_907268053 29 Left 907268043 1:53274728-53274750 CCCGGCAGTCCCTCTGCACATCA 0: 1
1: 0
2: 1
3: 18
4: 208
Right 907268053 1:53274780-53274802 ACTCTTACACTGAAATCTGCGGG 0: 1
1: 0
2: 1
3: 16
4: 160
907268045_907268053 20 Left 907268045 1:53274737-53274759 CCCTCTGCACATCACACACTTTC 0: 1
1: 0
2: 0
3: 25
4: 307
Right 907268053 1:53274780-53274802 ACTCTTACACTGAAATCTGCGGG 0: 1
1: 0
2: 1
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907268053 Original CRISPR ACTCTTACACTGAAATCTGC GGG Intronic
902907830 1:19572027-19572049 ATTCTGAGTCTGAAATCTGCAGG + Intergenic
905770498 1:40634995-40635017 ATTCTTACACTGGAATCTGCTGG - Intronic
906286875 1:44593272-44593294 ACTCCTACACTGAAAACATCTGG - Intronic
906349329 1:45044246-45044268 TTTATTACACTGATATCTGCAGG + Intronic
907268053 1:53274780-53274802 ACTCTTACACTGAAATCTGCGGG + Intronic
908302732 1:62778333-62778355 GCTCTTACACTGAAAGGTGGGGG - Intergenic
909473832 1:76059824-76059846 ACTCTAACTTTGAAATTTGCTGG + Intergenic
910045675 1:82911312-82911334 ACTTGAACACTGAAATCTGCAGG - Intergenic
910785458 1:90993130-90993152 ACTGGCAAACTGAAATCTGCTGG - Intronic
911034807 1:93530547-93530569 ACTCTGACAGTAAGATCTGCAGG + Intronic
912120739 1:106468416-106468438 TCTTTTTCATTGAAATCTGCTGG - Intergenic
913451336 1:118994596-118994618 CCTCTAGCACTGAAATCTGTTGG + Intergenic
913722635 1:121614461-121614483 ACTCTTTCGGTGGAATCTGCAGG - Intergenic
913733018 1:121737394-121737416 ACTCTTTCTGTGGAATCTGCAGG - Intergenic
913742395 1:121861719-121861741 ACTCTTTCGGTGGAATCTGCAGG - Intergenic
913769030 1:122226754-122226776 ACTCTTTCTGTGGAATCTGCAGG + Intergenic
913779571 1:122367963-122367985 ACTCTTTCGGTGGAATCTGCAGG + Intergenic
915558508 1:156673446-156673468 CCTCTTACCCTGAAAGCTGAGGG + Exonic
916056333 1:161071163-161071185 CTTCTTAGTCTGAAATCTGCTGG - Exonic
916276927 1:163004391-163004413 AGTCTTAGTCTGAAATCTGTAGG - Intergenic
916937470 1:169644610-169644632 ACTCTTTCTCTGAACTCTGGTGG - Intergenic
917499792 1:175575872-175575894 ACTTTTCCACTGGCATCTGCAGG - Intronic
918882523 1:190143702-190143724 ACTCTTACACTGCTATGTTCTGG + Intronic
919428882 1:197468770-197468792 ACTCTTACACAGCAATGTCCAGG - Intronic
919451453 1:197776457-197776479 GCTCTTACACAGAGATCTTCTGG + Intergenic
921320012 1:213929704-213929726 CCTCTCTCACTGAATTCTGCAGG - Intergenic
924238710 1:242021210-242021232 ACTCTTGAACTGAAATCTGATGG - Intergenic
1064166190 10:12988292-12988314 ACTTTTAAACTGAAATCTGAAGG - Intronic
1065778026 10:29140611-29140633 CCAATTACACTGAAATGTGCAGG + Intergenic
1068018306 10:51545852-51545874 ACTCTCATATTGAAATCTTCTGG - Intronic
1068418617 10:56760257-56760279 ACTGTTACACTGATATGTGATGG + Intergenic
1069111366 10:64451504-64451526 ACTTGTACACTGAATTGTGCTGG - Intergenic
1073143433 10:101263757-101263779 TGTCTCACTCTGAAATCTGCAGG + Intergenic
1074644934 10:115438344-115438366 ACTCTTGCAACAAAATCTGCAGG - Intronic
1074703905 10:116115013-116115035 ACGCTTACACTGACAACTACTGG + Intronic
1076326923 10:129631383-129631405 ACTCTTACAATGTAAACTTCTGG + Intronic
1082155971 11:48813612-48813634 ATTCTTTCTGTGAAATCTGCAGG + Intergenic
1082757886 11:57096180-57096202 ACACTTCCTCTGAAATCTGTAGG - Intergenic
1087477657 11:98656963-98656985 ACCCTTACCCTGGCATCTGCTGG - Intergenic
1090792220 11:130100745-130100767 ATTCTTACAGTGACATATGCCGG - Intronic
1094325127 12:29229859-29229881 ACTCTTAGACTGACATCTGAAGG + Intronic
1095317428 12:40782575-40782597 TGTCTAACACTGAAATTTGCTGG + Intronic
1095928328 12:47601981-47602003 AAATTTATACTGAAATCTGCCGG + Intergenic
1096882589 12:54684886-54684908 ACTCTTACACTGAAACCCTCAGG - Intergenic
1096903692 12:54912894-54912916 AATATTTCACTGAAATGTGCAGG - Intergenic
1097923936 12:65107152-65107174 ACTTTTACATTGCCATCTGCTGG + Intronic
1098034622 12:66289362-66289384 ACTCTTACACTGGAGTAAGCAGG + Intergenic
1101060707 12:100969069-100969091 ACTCTTAGAGTGAACACTGCAGG - Intronic
1104083386 12:125453001-125453023 TCTCTTACACTAAAATCTCAAGG + Intronic
1105964155 13:25370288-25370310 CAACTTACACTGAAAACTGCAGG - Intergenic
1108049518 13:46418446-46418468 ACTTTTATACTGAGATCTGAAGG - Intronic
1108611867 13:52091691-52091713 ACTCTTAGACTTAAGTCTTCAGG + Intronic
1109542038 13:63791729-63791751 ACTTTTATACTGAGATCTGAAGG - Intergenic
1110036049 13:70685869-70685891 ACTCTTACATTAAAATCTACTGG - Intergenic
1113442492 13:110340105-110340127 CCTCTTAGACTGGACTCTGCAGG - Intronic
1113818503 13:113193204-113193226 ACCTTTACACTGAAATCCACTGG - Intronic
1116324928 14:43520552-43520574 AAACTGCCACTGAAATCTGCAGG + Intergenic
1117068773 14:52037101-52037123 ACTCTTACACTTAGGTCTGTTGG + Intronic
1117805719 14:59488832-59488854 ACTTTTAAACTGAAATCAGAAGG - Intronic
1120681450 14:87485523-87485545 AATCTGACACTGAAAGCTGACGG - Intergenic
1120842575 14:89098639-89098661 TCTCTTCCTCTGAAATCTACAGG + Intergenic
1123173363 14:106395519-106395541 AATCTTACACAGAGAGCTGCTGG + Intergenic
1123929025 15:25149078-25149100 ACTATTACACAGAACACTGCTGG - Intergenic
1124611230 15:31210418-31210440 AAACCTACACTGAAATCTGATGG + Intergenic
1125747780 15:42008813-42008835 TCTCTGACACTGGAAACTGCTGG - Intronic
1132197278 15:99925012-99925034 ACAGTTACACTGAACTATGCTGG - Intergenic
1133472546 16:6089513-6089535 AATCTTAGACTAAAATCTGTGGG + Intronic
1134463821 16:14454862-14454884 ACACTTATACTGAAAGCTTCAGG + Intronic
1135965186 16:27029630-27029652 ACTCTTCCACCGAACTCTTCGGG - Intergenic
1137885339 16:52096913-52096935 ACTCTGACCCTTAAACCTGCAGG - Intergenic
1139458600 16:67104296-67104318 ACTCTTACCCTGCCCTCTGCTGG - Intergenic
1140136397 16:72209795-72209817 ACTCTGACAATGAACTCTCCTGG + Intergenic
1142311171 16:89314831-89314853 ACCCTTACCCTAAAACCTGCGGG + Intronic
1145556339 17:24779438-24779460 ACTCTTTCTGTGGAATCTGCAGG + Intergenic
1145590947 17:25282239-25282261 ACTCTTTCTGTGGAATCTGCAGG + Intergenic
1145653299 17:26189237-26189259 ACTCTTTCTGTGGAATCTGCAGG + Intergenic
1149226421 17:54477011-54477033 ACTCTCACACCCAAATTTGCTGG - Intergenic
1149688350 17:58552287-58552309 ACTCTTACTCCTAAATCTGATGG - Intergenic
1154478701 18:14795115-14795137 ACTCTAACATTGAAATATGCAGG + Intronic
1154479654 18:14807450-14807472 ATTCTAACATTGAAATATGCAGG + Intronic
1154480438 18:14818272-14818294 ATTCTAACATTGAAATATGCAGG + Intronic
1156291982 18:35755431-35755453 AGACTTACACTGAAACCTGAAGG + Intergenic
1156503685 18:37575802-37575824 ACTCTGACAGGGAAATCAGCAGG - Intergenic
1157092079 18:44648532-44648554 ACTCTTACACTGGGTTCTGAGGG + Intergenic
1159498046 18:69231332-69231354 AGTGATACAGTGAAATCTGCTGG - Intergenic
925343943 2:3156834-3156856 ACGCTTACCCTGCAATCTGACGG - Intergenic
926447428 2:12960974-12960996 ACTCTTAACCTGCAATGTGCTGG + Intergenic
928678584 2:33675308-33675330 ATTCTTCCACTTAAAGCTGCTGG - Intergenic
934442355 2:93892016-93892038 ACTCTTTTTCTGGAATCTGCAGG + Intergenic
936947608 2:117944759-117944781 ACTCTTCCAGTGAAGTCTGTTGG - Intronic
937053607 2:118912553-118912575 ACGCTGACACTGAGATTTGCAGG + Intergenic
938680881 2:133688906-133688928 ACACTTACACTCAAATTTCCAGG - Intergenic
940405307 2:153294327-153294349 AATCTTGCACTGAACTCAGCTGG - Intergenic
941248844 2:163135907-163135929 ACTAAGACACTGAAATCAGCAGG + Intergenic
941538090 2:166745779-166745801 ACACTTACAGTGATATCTGCGGG + Intergenic
944087889 2:195870402-195870424 ACTCTTTCTCTGTTATCTGCAGG - Intronic
944321006 2:198342248-198342270 ACTCCTATACTGAACACTGCAGG - Intronic
947517570 2:230820728-230820750 ACTCTTACATTGGAATCTGAAGG + Exonic
1173780079 20:45748637-45748659 ACTCTTATACTGAAATCTCATGG - Intronic
1173932405 20:46831867-46831889 ACTCTAACACTAAACTCAGCTGG + Intergenic
1175053259 20:56174641-56174663 TCTCTTACACACACATCTGCAGG + Intergenic
1175686924 20:61038002-61038024 ACTCTTTCACTGTTTTCTGCAGG + Intergenic
1176800887 21:13428854-13428876 ATTCTAACATTGAAATATGCAGG - Intergenic
1177102041 21:16910229-16910251 ATTCTTACTCTTAAATCTTCAGG - Intergenic
1179305139 21:40146671-40146693 ACTGTTTCACTGACACCTGCTGG - Intronic
950801752 3:15557582-15557604 ACACTTAGACTGACCTCTGCTGG + Intergenic
951776376 3:26314797-26314819 ACACACACACAGAAATCTGCGGG - Intergenic
952844175 3:37673057-37673079 CATGTTTCACTGAAATCTGCAGG + Intronic
953458760 3:43064530-43064552 ACTCTTACCCTGGATTATGCGGG - Intergenic
955758609 3:62252977-62252999 ATTATCACACTGAACTCTGCTGG + Intronic
956235661 3:67068385-67068407 ACTCTTACAGTTCAATCTCCAGG - Intergenic
956996876 3:74836278-74836300 AATCTTACTCTAAAATCTGCTGG + Intergenic
958076381 3:88685348-88685370 AATCTTCCACTGAAGTCTCCAGG - Intergenic
959034844 3:101349073-101349095 GCTATTAAACTGAGATCTGCTGG - Intronic
959488946 3:106963796-106963818 ACTTTTATACTGGAATCTGGTGG - Intergenic
961196675 3:125007824-125007846 ATTCTTAAACTGAAAACTCCTGG + Intronic
962435838 3:135365880-135365902 TCTCTTACCCTAAAATCAGCAGG - Intergenic
963306447 3:143658888-143658910 ACTTATGGACTGAAATCTGCTGG + Intronic
964057122 3:152474767-152474789 ACGCCAACACTGACATCTGCTGG - Intergenic
964725688 3:159812269-159812291 ACTTATACACTGAAAACTACAGG - Intronic
965424170 3:168500327-168500349 ACTCTGAACCTGAAATCAGCAGG - Intergenic
965630503 3:170727676-170727698 ACTCTTTCACTGATTTCTCCAGG + Intronic
970309667 4:14768763-14768785 TCTCTCAGACTGAAAGCTGCAGG + Intergenic
972386377 4:38570348-38570370 TCTTTGAGACTGAAATCTGCTGG - Intergenic
973733228 4:53843922-53843944 ACTCTTGCTTTCAAATCTGCTGG - Intronic
980658774 4:135828127-135828149 ATTATTACACTGAGATATGCTGG - Intergenic
980753875 4:137130554-137130576 ACTGTTCCCCTGAAATCTGCAGG + Intergenic
990839178 5:60056474-60056496 TCTCTTCCACTTAAATTTGCGGG - Intronic
991574238 5:68086022-68086044 ACTCTTAAACTGAATTTTGCAGG - Intergenic
995215141 5:109586866-109586888 ACTCTTACATTAAAATCTATTGG - Intergenic
998208139 5:140174236-140174258 ACTCTCACACTGAGACCTCCAGG + Intergenic
1001408991 5:171496822-171496844 ACTCTTGCTCTGAAATGAGCTGG + Intergenic
1003073936 6:2967029-2967051 ACTCTTAGACTGATATCATCTGG + Intronic
1004612098 6:17251936-17251958 ATTCTTCCACTGAATTCTGGAGG + Intergenic
1006646164 6:35515716-35515738 ATTTTTAAACTGAAATCTGAAGG + Intergenic
1006660284 6:35636018-35636040 ACTGTTACATTAAAATCTGTTGG + Intronic
1007352986 6:41288156-41288178 ATGCTTGAACTGAAATCTGCTGG + Intergenic
1007787540 6:44289796-44289818 ACTCCTGCCCTGAGATCTGCTGG + Intronic
1009476939 6:64104287-64104309 CCTCTTGTACTGAAATCTGATGG + Intronic
1009905453 6:69865979-69866001 GCACCTACACAGAAATCTGCAGG + Intergenic
1010117274 6:72328872-72328894 TTCCTGACACTGAAATCTGCTGG + Intronic
1011622116 6:89252788-89252810 ACTATTACACTGGAATTTGGGGG - Intergenic
1011903219 6:92326854-92326876 GCTCTGACACTGAAAGCTTCTGG + Intergenic
1012627335 6:101420217-101420239 ATTCTTACTCTGAAATTTACTGG - Intronic
1015099257 6:129455726-129455748 ATTTGTACACTGAAATCTGAAGG + Intronic
1017121841 6:151031289-151031311 ACACTGACACTGAAATCTCTTGG - Intronic
1017567375 6:155701867-155701889 ATTCTCACACAGAAATCAGCTGG - Intergenic
1020389022 7:7639437-7639459 ACCCTAAAAGTGAAATCTGCTGG + Intronic
1022092816 7:27118516-27118538 ACTCTTAAACTCAAAACTGCTGG - Intronic
1022752918 7:33251130-33251152 AATCTTCCTCTGAACTCTGCAGG - Intronic
1023315174 7:38928918-38928940 ACTCCTCCACTGAACTCTGCAGG - Intronic
1024628765 7:51230569-51230591 ACTCTTACAGTGGACTCTGAAGG + Intronic
1024854364 7:53760485-53760507 ATTCTTCCACTGAATTCTGTTGG + Intergenic
1028562881 7:92194836-92194858 GCTCTGACACTAAAATATGCTGG + Intergenic
1030189123 7:106793209-106793231 TGTCTTACACTGACACCTGCTGG - Intergenic
1031810171 7:126357726-126357748 GCTCTCACACTGCAGTCTGCTGG + Intergenic
1032598778 7:133270838-133270860 AATCCCACACTGAAATTTGCTGG + Intronic
1034870302 7:154677673-154677695 CCTGTCACACTGAAATCTGATGG - Intronic
1039258321 8:35743195-35743217 ATTCTTACAAAGAAATCAGCAGG - Intronic
1044060943 8:87634598-87634620 ACTCTTACATTAAAATCTACTGG + Intergenic
1044534947 8:93347804-93347826 ATCCTTACACTGGATTCTGCAGG + Intergenic
1046316248 8:112506417-112506439 ACACTTCCAATGAAATCTTCAGG + Intronic
1048811326 8:138289408-138289430 ACTCATTCACTGAGCTCTGCTGG + Intronic
1050340946 9:4638070-4638092 ACTCTTAGACTGTAAGCTCCTGG - Intronic
1050357659 9:4798248-4798270 ACTGTTAAACTGAACCCTGCAGG - Intronic
1051065087 9:13093362-13093384 ACTCTCACCATGCAATCTGCAGG - Intergenic
1053714227 9:40867851-40867873 ACTCTTTTTCTGGAATCTGCAGG + Intergenic
1054424700 9:65049807-65049829 ACTCTTTTTCTGGAATCTGCAGG + Intergenic
1058526729 9:105866488-105866510 CCTCTAACAGTGAAATCTGTGGG - Intergenic
1058666757 9:107325427-107325449 ACTTCTACACTGAAAACTACAGG - Intronic
1060428189 9:123524330-123524352 CCTCTTTCAATGATATCTGCGGG + Intronic
1186314551 X:8355088-8355110 ACAATTACACTGAACTCTACAGG - Intergenic
1187897577 X:23997242-23997264 ACTATTGCACTGAAATTTGAAGG - Intronic
1188011334 X:25059606-25059628 ACCATTACAGTGAACTCTGCAGG + Intergenic
1192094562 X:68197134-68197156 ACTCATACACTGGCATATGCTGG + Intronic
1197482511 X:127004775-127004797 ACTGTTGCACTTGAATCTGCAGG + Intergenic
1199928305 X:152492912-152492934 TTTATTACACTGAAATCTGGAGG - Intergenic
1202143430 Y:21752771-21752793 ACTCTAACACTGCAATGTGGAGG - Intergenic