ID: 907268054

View in Genome Browser
Species Human (GRCh38)
Location 1:53274781-53274803
Sequence CTCTTACACTGAAATCTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 224}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907268045_907268054 21 Left 907268045 1:53274737-53274759 CCCTCTGCACATCACACACTTTC 0: 1
1: 0
2: 0
3: 25
4: 307
Right 907268054 1:53274781-53274803 CTCTTACACTGAAATCTGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 224
907268048_907268054 -2 Left 907268048 1:53274760-53274782 CCGCCGTCCACGCGCTTGCCACT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 907268054 1:53274781-53274803 CTCTTACACTGAAATCTGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 224
907268044_907268054 29 Left 907268044 1:53274729-53274751 CCGGCAGTCCCTCTGCACATCAC 0: 1
1: 0
2: 1
3: 27
4: 250
Right 907268054 1:53274781-53274803 CTCTTACACTGAAATCTGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 224
907268050_907268054 -9 Left 907268050 1:53274767-53274789 CCACGCGCTTGCCACTCTTACAC 0: 1
1: 0
2: 0
3: 0
4: 33
Right 907268054 1:53274781-53274803 CTCTTACACTGAAATCTGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 224
907268046_907268054 20 Left 907268046 1:53274738-53274760 CCTCTGCACATCACACACTTTCC 0: 1
1: 0
2: 3
3: 29
4: 311
Right 907268054 1:53274781-53274803 CTCTTACACTGAAATCTGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 224
907268047_907268054 -1 Left 907268047 1:53274759-53274781 CCCGCCGTCCACGCGCTTGCCAC 0: 1
1: 0
2: 1
3: 0
4: 53
Right 907268054 1:53274781-53274803 CTCTTACACTGAAATCTGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 224
907268049_907268054 -5 Left 907268049 1:53274763-53274785 CCGTCCACGCGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 907268054 1:53274781-53274803 CTCTTACACTGAAATCTGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 224
907268043_907268054 30 Left 907268043 1:53274728-53274750 CCCGGCAGTCCCTCTGCACATCA 0: 1
1: 0
2: 1
3: 18
4: 208
Right 907268054 1:53274781-53274803 CTCTTACACTGAAATCTGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907268054 Original CRISPR CTCTTACACTGAAATCTGCG GGG Intronic
901295940 1:8161022-8161044 CACTTACACTGCCATCTGAGGGG + Intergenic
901578150 1:10217645-10217667 CTTTTCCCCTGAAATCTGCTTGG + Intronic
902817081 1:18922619-18922641 CTGTTAGGCTGAGATCTGCGTGG + Intronic
905790182 1:40785318-40785340 CCCTTCAACTGATATCTGCGGGG - Intronic
907268054 1:53274781-53274803 CTCTTACACTGAAATCTGCGGGG + Intronic
913305371 1:117424922-117424944 CTCTAACACTGAAATGTGGTAGG + Intronic
913451337 1:118994597-118994619 CTCTAGCACTGAAATCTGTTGGG + Intergenic
919451454 1:197776458-197776480 CTCTTACACAGAGATCTTCTGGG + Intergenic
924312225 1:242756238-242756260 CTCTGCCACTGAAATCTTGGAGG - Intergenic
1075508520 10:123048494-123048516 CTCTTTCACTGCAATCTTTGTGG - Intronic
1075609874 10:123844121-123844143 CTCTTTCACTGAATTCTCCCAGG - Intronic
1082327390 11:51163328-51163350 CTCTTATACTAGAATCTGCAAGG + Intergenic
1090144024 11:124299787-124299809 GTCTTAGACTGACCTCTGCGTGG - Intergenic
1090462931 11:126907908-126907930 CTCTTCCCCTGGGATCTGCGTGG + Intronic
1093367369 12:18320497-18320519 CTCTTACACTGACATTTTGGCGG + Intronic
1093513968 12:19963554-19963576 CTCTGACACTGAAAACTGTCAGG + Intergenic
1094007139 12:25766775-25766797 CTGTTACACTGAAATCATCCTGG - Intergenic
1094047060 12:26178974-26178996 CTCCTACACTGTAAGCTGTGGGG - Intronic
1095977528 12:47949935-47949957 CTGTTAGACTAAACTCTGCGAGG - Intergenic
1097676239 12:62604702-62604724 CTAATACCCTGAAGTCTGCGTGG + Intergenic
1100008581 12:89924726-89924748 ATCTTACAATGAAAACTGGGAGG - Intergenic
1107602069 13:42023759-42023781 CTCTTTCACTGATCTCTGCATGG - Intergenic
1107660928 13:42638406-42638428 CTCTTACACTGAGAACTGAGTGG + Intergenic
1113442491 13:110340104-110340126 CTCTTAGACTGGACTCTGCAGGG - Intronic
1115202643 14:30871094-30871116 CTCTAACACTGATACCTGGGTGG - Intergenic
1121789708 14:96689956-96689978 CTCTGACACTGACATTTGCCAGG + Intergenic
1125036642 15:35132789-35132811 CTCTTCCCCTGAAATTTGCATGG - Intergenic
1129219201 15:74121694-74121716 CCCTTACACTGAATTGTGCCTGG + Intronic
1131069530 15:89457111-89457133 CTCTTACATAAAAATCTGGGTGG + Intergenic
1133455860 16:5941979-5942001 ATCTGACACTGAAACCTGAGTGG + Intergenic
1135965185 16:27029629-27029651 CTCTTCCACCGAACTCTTCGGGG - Intergenic
1140806858 16:78540577-78540599 CTCTGACTCTGAAATCTGCATGG + Intronic
1144398103 17:14865610-14865632 CATTCACACTGAAATCTGCAAGG + Intergenic
1144958418 17:19031378-19031400 CTCTTACACACAAATCTGCCAGG + Intronic
1144976740 17:19143146-19143168 CTCTTACACACAAATCTGCCAGG - Intronic
1145418652 17:22747319-22747341 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145418827 17:22749698-22749720 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145418996 17:22752074-22752096 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145419159 17:22754453-22754475 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145419331 17:22756832-22756854 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145419505 17:22759210-22759232 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145420001 17:22816165-22816187 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145420173 17:22818544-22818566 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145420424 17:22822117-22822139 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145420596 17:22824496-22824518 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145420769 17:22826876-22826898 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145420939 17:22829255-22829277 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145421111 17:22831633-22831655 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145421286 17:22834013-22834035 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145421637 17:22838771-22838793 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145421814 17:22841150-22841172 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145421981 17:22843530-22843552 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145422157 17:22845908-22845930 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145422335 17:22848287-22848309 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145422509 17:22850666-22850688 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145422685 17:22853045-22853067 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145422857 17:22855424-22855446 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145423031 17:22857802-22857824 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145423204 17:22860181-22860203 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145423380 17:22862560-22862582 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145423551 17:22864939-22864961 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145423724 17:22867318-22867340 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145423894 17:22869697-22869719 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145424065 17:22872076-22872098 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145424233 17:22874455-22874477 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145424407 17:22876834-22876856 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145424585 17:22879213-22879235 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145424763 17:22881592-22881614 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145424934 17:22883971-22883993 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145425103 17:22886350-22886372 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145425269 17:22888729-22888751 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145425444 17:22891108-22891130 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145425620 17:22893487-22893509 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145425791 17:22895865-22895887 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145425965 17:22898243-22898265 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145426135 17:22900622-22900644 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145426311 17:22903002-22903024 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145426650 17:22907758-22907780 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145426817 17:22910138-22910160 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145426991 17:22912517-22912539 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145427157 17:22914899-22914921 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145427326 17:22917278-22917300 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145427499 17:22919657-22919679 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145427673 17:22922037-22922059 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145427845 17:22924415-22924437 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145428018 17:22926794-22926816 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145428189 17:22929173-22929195 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145428363 17:22931552-22931574 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145428538 17:22933932-22933954 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145428709 17:22936311-22936333 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145428881 17:22938691-22938713 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145429055 17:22941071-22941093 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145429403 17:22945829-22945851 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145429570 17:22948208-22948230 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145429743 17:22950586-22950608 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145429918 17:22952965-22952987 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145430090 17:22955343-22955365 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145430264 17:22957722-22957744 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145430438 17:22960102-22960124 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145430616 17:22962482-22962504 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145430961 17:22967243-22967265 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145431139 17:22969622-22969644 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145431315 17:22972003-22972025 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145431488 17:22974382-22974404 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145431662 17:22976762-22976784 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145431830 17:22979141-22979163 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145432006 17:22981520-22981542 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145432180 17:22983900-22983922 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145432351 17:22986279-22986301 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145432522 17:22988661-22988683 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145432873 17:22993425-22993447 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145433044 17:22995804-22995826 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145433217 17:22998183-22998205 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145433469 17:23001740-23001762 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145433642 17:23004120-23004142 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145433818 17:23006499-23006521 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145433991 17:23008878-23008900 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145434347 17:23013638-23013660 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145434520 17:23016017-23016039 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145434863 17:23020776-23020798 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145435035 17:23023155-23023177 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145435205 17:23025536-23025558 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145435372 17:23027914-23027936 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145435545 17:23030294-23030316 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145435716 17:23032673-23032695 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145436052 17:23037431-23037453 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145436229 17:23039810-23039832 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145436401 17:23042191-23042213 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145436577 17:23044570-23044592 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145436741 17:23046950-23046972 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145436913 17:23049330-23049352 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145437259 17:23054090-23054112 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145437432 17:23056469-23056491 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145437611 17:23058848-23058870 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145437783 17:23061227-23061249 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145437952 17:23063604-23063626 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145438122 17:23065983-23066005 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145438290 17:23068362-23068384 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145438459 17:23070741-23070763 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145438633 17:23073121-23073143 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145438803 17:23075503-23075525 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145438975 17:23077885-23077907 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145439146 17:23080265-23080287 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145439314 17:23082643-23082665 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145439481 17:23085022-23085044 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145439654 17:23087401-23087423 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145439908 17:23090972-23090994 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145440253 17:23095728-23095750 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145440336 17:23096920-23096942 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145440420 17:23098107-23098129 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145440597 17:23100488-23100510 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145440769 17:23102868-23102890 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145440939 17:23105247-23105269 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145441110 17:23107626-23107648 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145441285 17:23110006-23110028 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145441462 17:23112387-23112409 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145441635 17:23114766-23114788 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145441806 17:23117146-23117168 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145441980 17:23119525-23119547 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145442333 17:23124285-23124307 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145442508 17:23126666-23126688 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145442678 17:23129046-23129068 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145442851 17:23131429-23131451 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145443020 17:23133808-23133830 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145443443 17:23139760-23139782 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145443612 17:23142139-23142161 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145443784 17:23144518-23144540 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145443957 17:23146900-23146922 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145444131 17:23149279-23149301 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145444310 17:23151660-23151682 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145444484 17:23154039-23154061 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145444657 17:23156418-23156440 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145444835 17:23158798-23158820 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145445010 17:23161177-23161199 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145445185 17:23163558-23163580 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145445357 17:23165937-23165959 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145445532 17:23168316-23168338 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145445705 17:23170696-23170718 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145445880 17:23173077-23173099 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145446049 17:23175456-23175478 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145446220 17:23177835-23177857 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145446399 17:23180214-23180236 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145446568 17:23182593-23182615 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145446738 17:23184969-23184991 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145446906 17:23187349-23187371 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145447080 17:23189729-23189751 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145447251 17:23192107-23192129 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1145447419 17:23194488-23194510 CTCTTTCTCTGGAATCTGCAAGG + Intergenic
1146765194 17:35514279-35514301 CTCTTAGACATAAATCTGCGAGG - Intronic
1157092080 18:44648533-44648555 CTCTTACACTGGGTTCTGAGGGG + Intergenic
1165075976 19:33280094-33280116 CACTTCCACTGATATCTGGGAGG + Intergenic
1167793340 19:51693724-51693746 CTCTGACACCGAAATCAGTGAGG + Intergenic
1168394242 19:56034647-56034669 CTCTTAAAGTGAAATCGGTGTGG + Intronic
926332395 2:11836402-11836424 CTGTTAGACTGGAATGTGCGGGG - Intergenic
938991659 2:136635896-136635918 CTTTTACACAGAAATGTGGGAGG - Intergenic
942196271 2:173523597-173523619 CTCTTTCACTGAAGCCTGAGTGG + Intergenic
944346136 2:198668132-198668154 CCCTGACTCTGAAATCTGGGAGG + Intergenic
945812563 2:214566453-214566475 CTCTCAGACTGAAATTTGTGTGG + Intronic
947336376 2:229089576-229089598 TTCATAAAATGAAATCTGCGAGG - Intronic
947544493 2:231001325-231001347 CTCTTCCATTGAGATCTGTGAGG - Intronic
949286782 3:2415959-2415981 ACCTTATACTGAAATCTGCCCGG - Intronic
949741763 3:7242691-7242713 CTCTTCGTCTGAAATCTGGGTGG - Intronic
949948135 3:9206654-9206676 CACTTCCACTGAGATCTGCATGG + Intronic
951061776 3:18216903-18216925 ATCTCACACTGAAAGCTGTGAGG - Intronic
951776375 3:26314796-26314818 CACACACACAGAAATCTGCGGGG - Intergenic
956360201 3:68439241-68439263 CACTTACACTGAGATTTGGGAGG - Intronic
956858158 3:73296155-73296177 ATATTACACTGAACTCTTCGGGG - Intergenic
958213837 3:90533081-90533103 CTCTTTTTCTGGAATCTGCGAGG - Intergenic
962435837 3:135365879-135365901 CTCTTACCCTAAAATCAGCAGGG - Intergenic
962755302 3:138461515-138461537 CTCATTCACTGACATCTGCATGG + Intronic
964387008 3:156158397-156158419 CTCTTACACTGAAATTAACCAGG + Intronic
968476450 4:811973-811995 TTCTTGCACTGAAATCTCCTTGG + Intronic
974350706 4:60742337-60742359 CTCTTTATCTGAAATCTGCCTGG + Intergenic
977325669 4:95572167-95572189 CTCTTACAGTAAATTCTGCCAGG + Intergenic
979000949 4:115218620-115218642 CTCCTACTCTGAATTCTGCAAGG - Intergenic
982056633 4:151556559-151556581 ATTATACACTGAAATCTGCACGG - Intronic
985834621 5:2261362-2261384 CTCTTTCCCTGAAGTCTGCATGG - Intergenic
989809064 5:45650319-45650341 ATCTTACACTGGAATCTCTGTGG + Intronic
990839177 5:60056473-60056495 CTCTTCCACTTAAATTTGCGGGG - Intronic
991574237 5:68086021-68086043 CTCTTAAACTGAATTTTGCAGGG - Intergenic
994783542 5:104124822-104124844 CTCTAACACTGCAATCTGCCTGG - Intergenic
1006668289 6:35713576-35713598 CTCCTACACTGACTTCTGAGAGG - Intronic
1007180754 6:39927536-39927558 CCCTTACTCTGACATCTGTGCGG + Exonic
1018559216 6:165084053-165084075 CTCCTGCTCTGAAATTTGCGTGG + Intergenic
1030189122 7:106793208-106793230 GTCTTACACTGACACCTGCTGGG - Intergenic
1030367938 7:108667823-108667845 ATCTGACAATGAAATCTGCCTGG - Intergenic
1039790172 8:40869337-40869359 CCCTTACACTGATATCTAAGGGG + Intronic
1044523511 8:93225897-93225919 CTCTGACACTGAAATCTGGAAGG - Intergenic
1053656564 9:40222822-40222844 CTCTGACCCTGAAGTCTGTGTGG - Intergenic
1054528051 9:66153463-66153485 CTCTGGCCCTGAAATCTGTGTGG + Intergenic
1058727973 9:107821709-107821731 CACTTACTCTGAAATTTGCAAGG + Intergenic
1186910214 X:14155841-14155863 TTCTTACATAGAAATCTGCTAGG - Intergenic
1202056813 Y:20843245-20843267 CACTTACATTGACAGCTGCGAGG - Intergenic