ID: 907268055

View in Genome Browser
Species Human (GRCh38)
Location 1:53274792-53274814
Sequence AAATCTGCGGGGACCCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907268051_907268055 -9 Left 907268051 1:53274778-53274800 CCACTCTTACACTGAAATCTGCG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 907268055 1:53274792-53274814 AAATCTGCGGGGACCCTCACAGG 0: 1
1: 0
2: 0
3: 2
4: 59
907268047_907268055 10 Left 907268047 1:53274759-53274781 CCCGCCGTCCACGCGCTTGCCAC 0: 1
1: 0
2: 1
3: 0
4: 53
Right 907268055 1:53274792-53274814 AAATCTGCGGGGACCCTCACAGG 0: 1
1: 0
2: 0
3: 2
4: 59
907268048_907268055 9 Left 907268048 1:53274760-53274782 CCGCCGTCCACGCGCTTGCCACT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 907268055 1:53274792-53274814 AAATCTGCGGGGACCCTCACAGG 0: 1
1: 0
2: 0
3: 2
4: 59
907268050_907268055 2 Left 907268050 1:53274767-53274789 CCACGCGCTTGCCACTCTTACAC 0: 1
1: 0
2: 0
3: 0
4: 33
Right 907268055 1:53274792-53274814 AAATCTGCGGGGACCCTCACAGG 0: 1
1: 0
2: 0
3: 2
4: 59
907268049_907268055 6 Left 907268049 1:53274763-53274785 CCGTCCACGCGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 907268055 1:53274792-53274814 AAATCTGCGGGGACCCTCACAGG 0: 1
1: 0
2: 0
3: 2
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907268055 Original CRISPR AAATCTGCGGGGACCCTCAC AGG Intronic
900710536 1:4110492-4110514 ACCTCAGCGGGGACCCTCAGGGG + Intergenic
904583634 1:31566407-31566429 AATTCTGAGGTGACCCTCACTGG + Intergenic
906714073 1:47954114-47954136 GAATCTGTAGTGACCCTCACTGG - Intronic
907268055 1:53274792-53274814 AAATCTGCGGGGACCCTCACAGG + Intronic
913276013 1:117138394-117138416 AAAACTGCTGTGAACCTCACAGG + Intergenic
915633555 1:157171017-157171039 ACATCTGCCGGGCACCTCACTGG + Intergenic
915636905 1:157193913-157193935 ACATCTGCCGGGGACCTCACTGG + Intergenic
924245013 1:242075365-242075387 AAATGTGCCAGGACCATCACTGG - Intergenic
1063142757 10:3269991-3270013 AAATCTGCGGGGATGGTCATTGG + Intergenic
1068657077 10:59586898-59586920 AAATGTTTGGAGACCCTCACAGG - Intergenic
1070459364 10:76649268-76649290 AAATCTGCAGGGTCGCTCAATGG + Intergenic
1077336553 11:2007541-2007563 GAATTTCCGGGGACACTCACAGG + Intergenic
1077336562 11:2007578-2007600 GAATTTCCGGGGACACTCACAGG + Intergenic
1078421924 11:11219539-11219561 GAAACTGGGGGGACGCTCACTGG - Intergenic
1078476197 11:11632551-11632573 AAATCTGCAGGGGCTCTCATAGG - Intergenic
1202819537 11_KI270721v1_random:62723-62745 GAATTTCCGGGGACACTCACAGG + Intergenic
1202819546 11_KI270721v1_random:62760-62782 GAATTTCCGGGGACACTCACAGG + Intergenic
1095929191 12:47608813-47608835 AACTGTGAGAGGACCCTCACTGG - Intergenic
1113889718 13:113729716-113729738 ACAGCTGTGGGGACCGTCACAGG - Intronic
1123716876 15:23039981-23040003 AAATCCGCAGAGACCATCACTGG - Intergenic
1124343779 15:28907713-28907735 GAATCTGTGGGGACTCTCCCTGG + Intronic
1124456352 15:29846290-29846312 AGAACTGGGGGGACCCTCACTGG - Intronic
1127981112 15:64035852-64035874 CACTCTGCTGGGACCCTCCCTGG - Intronic
1131968653 15:97871241-97871263 AAATCTGCAGGGACTCACAGAGG - Intergenic
1142390826 16:89798647-89798669 AGATGTGCGGAGACCCTTACAGG - Intronic
1162551893 19:11362494-11362516 ACATCTGCGGGGAGCCGGACTGG - Exonic
1163318380 19:16556942-16556964 GCTTCTGCGGGGAACCTCACTGG + Intronic
1167210051 19:48128474-48128496 AAAGCTGGGGGGACTCTCCCGGG + Intronic
927036561 2:19183808-19183830 AAATCTGCTGTTACCCTCAAAGG + Intergenic
932401826 2:71486115-71486137 ATGACTCCGGGGACCCTCACTGG - Intronic
936011188 2:108926460-108926482 GAATCTGCGGCGTCCCTTACAGG - Intronic
938260463 2:129892079-129892101 ATATCTGCTGGGTCCCTCATCGG + Intergenic
948204411 2:236155561-236155583 AACTCTGCTGGGGCCCTCAGAGG - Intergenic
948789631 2:240370552-240370574 AAATCTCCAGGGACTCTCAATGG - Intergenic
1179180444 21:39040282-39040304 ACATGTGGGGGGACCCTCAAAGG + Intergenic
1180048326 21:45319933-45319955 AAATCTTAGGGGAGACTCACAGG - Intergenic
1182553210 22:31113181-31113203 AAAACTGCTGTGAACCTCACAGG + Intronic
1184093005 22:42302127-42302149 AGAGCTGAGGGGCCCCTCACTGG + Intronic
950148254 3:10666995-10667017 AACTCTGCCTGGACCCTTACAGG - Intronic
956273140 3:67469309-67469331 AAATCAGTGGGGAACCTAACTGG + Intronic
959543130 3:107563285-107563307 AAATCTGCAAGGAGCTTCACAGG - Intronic
960170016 3:114449424-114449446 AAGTCTGCGATGACCCTCTCAGG - Intronic
960176832 3:114527245-114527267 AAATCTGATGGGAGTCTCACAGG + Intronic
961524994 3:127490929-127490951 AAATCAGAGGGGATCCTCAAGGG + Intergenic
963897720 3:150704077-150704099 AAGTCTGCGGTGGCCCCCACCGG - Intergenic
968489966 4:884675-884697 AACTCTGCAAGGACCCTGACAGG + Intronic
968589316 4:1449758-1449780 AAGACTCCGGGGACCCCCACAGG - Intergenic
969879187 4:10158969-10158991 GAATCTGAGGGGACCCACAAAGG - Intergenic
974083212 4:57233795-57233817 AGATCTGGGGGGGCCCTGACTGG - Intergenic
977553699 4:98467985-98468007 AAACCTCTGGGGACCCGCACTGG - Intergenic
987897763 5:23970227-23970249 AAAACTGCAGGCACCCTCATTGG + Intronic
990683171 5:58268988-58269010 AAATCTTTGGGGGCCTTCACAGG - Intergenic
1003292155 6:4788835-4788857 AAGCCTGCGGGGATCCTAACAGG - Intronic
1018592943 6:165447375-165447397 GAATCTGCTGGGGCCCTCATGGG + Intronic
1019622517 7:1999547-1999569 GGGACTGCGGGGACCCTCACAGG + Intronic
1034726820 7:153343805-153343827 CAATCTGGGGGAACCCTGACTGG + Intergenic
1038962637 8:32538163-32538185 AAATATGCTGAGACCCTCAGAGG - Intronic
1046524637 8:115368984-115369006 TAATCAGTGGGGACCCTCAATGG - Intergenic
1196504387 X:116424345-116424367 ATAGCTGGGGGGACCTTCACAGG - Intergenic
1197014286 X:121604981-121605003 AAACCTGCTGGGCTCCTCACAGG + Intergenic
1199433054 X:147782380-147782402 CAATCTCCTTGGACCCTCACTGG - Intergenic
1201306896 Y:12558539-12558561 AAATCTGCTGTGACTCTCTCTGG + Intergenic