ID: 907268056

View in Genome Browser
Species Human (GRCh38)
Location 1:53274793-53274815
Sequence AATCTGCGGGGACCCTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907268051_907268056 -8 Left 907268051 1:53274778-53274800 CCACTCTTACACTGAAATCTGCG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG 0: 1
1: 0
2: 0
3: 4
4: 55
907268048_907268056 10 Left 907268048 1:53274760-53274782 CCGCCGTCCACGCGCTTGCCACT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG 0: 1
1: 0
2: 0
3: 4
4: 55
907268047_907268056 11 Left 907268047 1:53274759-53274781 CCCGCCGTCCACGCGCTTGCCAC 0: 1
1: 0
2: 1
3: 0
4: 53
Right 907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG 0: 1
1: 0
2: 0
3: 4
4: 55
907268049_907268056 7 Left 907268049 1:53274763-53274785 CCGTCCACGCGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG 0: 1
1: 0
2: 0
3: 4
4: 55
907268050_907268056 3 Left 907268050 1:53274767-53274789 CCACGCGCTTGCCACTCTTACAC 0: 1
1: 0
2: 0
3: 0
4: 33
Right 907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG 0: 1
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907268056 Original CRISPR AATCTGCGGGGACCCTCACA GGG Intronic
900206025 1:1432245-1432267 AAAGTGAGGGGACCCACACAAGG + Intergenic
906143802 1:43548493-43548515 AATCTGCGGGAAGTCCCACAGGG - Intronic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
910850032 1:91641202-91641224 CATCTGCTGGGACCCTGATATGG + Intergenic
917952387 1:180053062-180053084 AATCTGCGGTGACTCTCTGAAGG - Exonic
922513352 1:226187291-226187313 AATTTGTGGGGACCCTCATTAGG + Intergenic
923362254 1:233223260-233223282 AATCAACGGTGACCCTGACAAGG + Intronic
1070829410 10:79409482-79409504 AATCAGAGGGGACCCCTACAGGG - Intronic
1075953753 10:126504793-126504815 CCTCTGCGGGGGCCCCCACAGGG + Exonic
1078421923 11:11219538-11219560 AAACTGGGGGGACGCTCACTGGG - Intergenic
1081708458 11:45200719-45200741 AGTCTGCAGGGACCCTCCCCTGG - Intronic
1092780793 12:11984928-11984950 AACCTGCAGAGACGCTCACATGG + Intergenic
1098875244 12:75860153-75860175 AATCTGCTGAGATCCACACATGG - Intergenic
1118072707 14:62263304-62263326 AATCTCCAGGGAACCTCAGAAGG - Intergenic
1121553961 14:94822442-94822464 AATCCTTGGGGAGCCTCACAGGG + Intergenic
1123203817 14:106692639-106692661 AAGCTGAGGGGGCTCTCACAGGG - Intergenic
1123208847 14:106739146-106739168 AAGCTGAGGGGGCTCTCACAGGG - Intergenic
1123584702 15:21747342-21747364 CATCTGCTGGGATACTCACATGG + Intergenic
1123621347 15:22189949-22189971 CATCTGCTGGGATACTCACATGG + Intergenic
1124343780 15:28907714-28907736 AATCTGTGGGGACTCTCCCTGGG + Intronic
1124456351 15:29846289-29846311 GAACTGGGGGGACCCTCACTGGG - Intronic
1130765934 15:86871280-86871302 TATCTGCAGAGACCCTCAAAAGG + Intronic
1135036728 16:19084800-19084822 AATCTGTGGAGACGCTCACATGG + Intergenic
1139356706 16:66371197-66371219 ACTCTGTGGGGACTCTCAAATGG - Intronic
1144847434 17:18227208-18227230 GAGCTGCCAGGACCCTCACACGG + Intronic
1149575729 17:57711312-57711334 CACCTTTGGGGACCCTCACATGG + Intergenic
1150129135 17:62657549-62657571 AAGGTGCAGGGCCCCTCACAAGG - Intronic
1151545473 17:74790369-74790391 AATCTGCGGGGAGCCTCTCCAGG - Intronic
1163032247 19:14552416-14552438 AAGCTGGGTGGACACTCACATGG + Intronic
934529710 2:95077237-95077259 AACCTGCAGGGACCCTACCAGGG + Intergenic
934953492 2:98595713-98595735 AATCTGCAGCTACCCTCTCATGG - Intergenic
1176428711 21:6563628-6563650 AGCCTGCGGGGGCTCTCACAGGG - Intergenic
1179704201 21:43171944-43171966 AGCCTGCGGGGGCTCTCACAGGG - Intronic
1181037558 22:20177248-20177270 AATCTAGGGGGAACCTGACATGG - Intergenic
1184098670 22:42330080-42330102 AATCTGCAGGGCCACTCAGATGG - Intronic
954976577 3:54700945-54700967 AATATGCTGGGACTCTCAGAGGG - Intronic
959543129 3:107563284-107563306 AATCTGCAAGGAGCTTCACAGGG - Intronic
959916381 3:111821087-111821109 AATCACTGGGGACCCTGACATGG - Intronic
960420991 3:117444934-117444956 AATGGGCGGGGTCCCTGACAAGG - Intergenic
965522991 3:169687563-169687585 GCTCTGTGGGGACCCTCTCAAGG - Intergenic
969566741 4:7983205-7983227 CATCTGCGGGGACTCTCGCATGG + Intronic
969883170 4:10192469-10192491 AATTTGCAGGAACACTCACACGG + Intergenic
970296723 4:14638778-14638800 AATCTTCAGGGACCCTGAAAGGG + Intergenic
979912673 4:126389120-126389142 AATCTGCAGCTACCCTCTCATGG + Intergenic
993653006 5:90544489-90544511 CATCTGTGGGGACCCCAACATGG - Intronic
1016433004 6:144007916-144007938 GATCTGCGGGGTCCCGCACCCGG + Intronic
1017862530 6:158412355-158412377 AGTCTGAGGGAAGCCTCACAGGG - Intronic
1018226478 6:161634256-161634278 CATCTGCGGGGACGCTCACCAGG - Intronic
1023888126 7:44375171-44375193 CCTCTGAGGGGACCCTCCCAGGG + Intergenic
1025969551 7:66309502-66309524 AACCTGCTGTGACCCTCAGAGGG - Intronic
1026973079 7:74479599-74479621 GAGCTGCCGGGACCCTCCCAGGG - Intronic
1035328097 7:158077723-158077745 AGTCTGCAGAGACCCTCACCCGG - Intronic
1038962636 8:32538162-32538184 AATATGCTGAGACCCTCAGAGGG - Intronic
1040306406 8:46214155-46214177 AAAATGCTGGGACCCTCCCAAGG + Intergenic
1040636516 8:49280620-49280642 AAACTGCAGGGAACCTAACAAGG - Intergenic
1044802409 8:95970906-95970928 AACCTGAGGCGACCCTCAAAGGG + Intergenic
1057447099 9:95124225-95124247 AAACTGCGGAGAGCTTCACAGGG + Intronic
1059102240 9:111483002-111483024 AATAGGCGGTGACCCTCAGATGG - Intronic
1061793498 9:133070978-133071000 ACTCTGCAGGGACCCCAACATGG + Exonic
1061796106 9:133086777-133086799 ACTCTGCAGGGACCCCAACATGG + Intronic