ID: 907268058

View in Genome Browser
Species Human (GRCh38)
Location 1:53274805-53274827
Sequence CCCTCACAGGGTGACTCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907268049_907268058 19 Left 907268049 1:53274763-53274785 CCGTCCACGCGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 907268058 1:53274805-53274827 CCCTCACAGGGTGACTCTGTTGG 0: 1
1: 0
2: 1
3: 17
4: 133
907268051_907268058 4 Left 907268051 1:53274778-53274800 CCACTCTTACACTGAAATCTGCG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 907268058 1:53274805-53274827 CCCTCACAGGGTGACTCTGTTGG 0: 1
1: 0
2: 1
3: 17
4: 133
907268050_907268058 15 Left 907268050 1:53274767-53274789 CCACGCGCTTGCCACTCTTACAC 0: 1
1: 0
2: 0
3: 0
4: 33
Right 907268058 1:53274805-53274827 CCCTCACAGGGTGACTCTGTTGG 0: 1
1: 0
2: 1
3: 17
4: 133
907268048_907268058 22 Left 907268048 1:53274760-53274782 CCGCCGTCCACGCGCTTGCCACT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 907268058 1:53274805-53274827 CCCTCACAGGGTGACTCTGTTGG 0: 1
1: 0
2: 1
3: 17
4: 133
907268047_907268058 23 Left 907268047 1:53274759-53274781 CCCGCCGTCCACGCGCTTGCCAC 0: 1
1: 0
2: 1
3: 0
4: 53
Right 907268058 1:53274805-53274827 CCCTCACAGGGTGACTCTGTTGG 0: 1
1: 0
2: 1
3: 17
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907268058 Original CRISPR CCCTCACAGGGTGACTCTGT TGG Intronic
901715471 1:11150094-11150116 CCTTCACAGGGTGCCTGTGAGGG + Intronic
901776138 1:11561488-11561510 CCATCTCAGGGTGACTCTCCGGG - Intergenic
902326179 1:15702237-15702259 CCCTCACATGGCGATGCTGTAGG - Intronic
903372444 1:22845450-22845472 CCCTCACTTGGTGACAGTGTGGG + Intronic
906645201 1:47469866-47469888 ACAGCCCAGGGTGACTCTGTTGG - Intergenic
907268058 1:53274805-53274827 CCCTCACAGGGTGACTCTGTTGG + Intronic
909835546 1:80249905-80249927 CCCTGACAAGCTGGCTCTGTGGG + Intergenic
910758576 1:90714697-90714719 CTCTCACAGGGGGACTCTCACGG + Exonic
915026725 1:152837563-152837585 CCCTCACAGGAAGACACTGGAGG + Intergenic
916999418 1:170340172-170340194 CCCTGCCTGGGTGACACTGTGGG + Intergenic
918301325 1:183206817-183206839 CCTACACAGGCTGTCTCTGTTGG - Intronic
920648098 1:207817985-207818007 ACCTCCCAGGGTGACTCATTTGG - Intergenic
923557319 1:235011267-235011289 CTCTCCCATGGGGACTCTGTTGG + Intergenic
1067444551 10:46332657-46332679 CCCTCACAGGCTTTCTGTGTTGG + Intergenic
1069868726 10:71520369-71520391 CCAGCACAGGGTGACCCTGGAGG + Intronic
1071063708 10:81605411-81605433 CATTCACAGGTTGACTCAGTTGG + Intergenic
1076809971 10:132881392-132881414 CCCTCTCTGGGTGGCTCTGTGGG + Intronic
1077101752 11:825591-825613 CCCTCACACGGTGACACAGTGGG + Intergenic
1077442648 11:2575793-2575815 CCCTCTCAGGGTGTGTCTGAGGG - Intronic
1084462543 11:69303925-69303947 CTCTCAAAGGGTGAGTTTGTTGG + Intronic
1084506843 11:69573692-69573714 CTTTCACTGGGTGACTCTGAGGG + Intergenic
1086588231 11:88481092-88481114 ACCTCACAGGGTGATTATGAGGG - Intergenic
1089393387 11:118117296-118117318 CTCTCACAGGGTGACAGTGGTGG + Exonic
1097444672 12:59655235-59655257 TACTCACAGAGTAACTCTGTTGG - Intronic
1101901123 12:108792091-108792113 CTTTCACAGGGTGATTCTGCTGG - Intronic
1101997053 12:109533069-109533091 TCCTCACATGGTCTCTCTGTGGG + Intronic
1107437031 13:40389250-40389272 TCCTCACAGGGGGCCTCTGAAGG - Intergenic
1109514140 13:63419372-63419394 CCCTTACTGGGTCACTATGTGGG - Intergenic
1112520102 13:100087706-100087728 CTCTCTCAAGGTGACTCTGCAGG + Intergenic
1112888423 13:104202901-104202923 CCATCACAGGGTGACCCTGAGGG + Intergenic
1113529532 13:111011993-111012015 CCCTCACAGTGTGACTTTGTAGG + Intergenic
1113659608 13:112096582-112096604 CCCTCACAGGATGACTCCGGGGG - Intergenic
1114683325 14:24505646-24505668 CCCCTACAGGGAGACTCTGGGGG - Exonic
1115630724 14:35242322-35242344 CATTCACAGGGTTACTCTCTTGG + Intronic
1117235419 14:53769501-53769523 GACTCACAGGGAGACTCTGGTGG - Intergenic
1118085985 14:62417910-62417932 CCCCCAGAGGGGGACTCTGTAGG - Intergenic
1119140280 14:72261141-72261163 CCTTCACAGGGTGCATTTGTAGG - Intronic
1121026506 14:90620341-90620363 GCCGCTCAGGGTGCCTCTGTGGG + Intronic
1121173799 14:91875542-91875564 CTCTCACAGGGTGCTTTTGTGGG - Intronic
1122536304 14:102465970-102465992 CCCCCATTTGGTGACTCTGTTGG + Intronic
1122825555 14:104368873-104368895 CCCTAACTGGGAGGCTCTGTGGG - Intergenic
1132708996 16:1258323-1258345 CCTTCCCAGGGTGACTCTGGAGG + Exonic
1133395864 16:5446952-5446974 TCCTCACAAGATGACTGTGTGGG - Intergenic
1134435400 16:14252016-14252038 GCCTCACAGGGTTACCTTGTTGG - Exonic
1135623354 16:23974851-23974873 CCTTCACAGGGTGACACCATCGG + Intronic
1135723530 16:24836860-24836882 ACCTCACAGGGAGACGCTATGGG + Intergenic
1139263744 16:65620814-65620836 CACTGAAAGGGTGACTCTGTGGG - Intergenic
1139590423 16:67930082-67930104 CCCTCTCAGGGTGACTCCGGAGG - Exonic
1140472812 16:75224696-75224718 CTCCCACAGGGCGACTCTGGCGG + Exonic
1141113229 16:81287460-81287482 CCCCCAGATGGTGTCTCTGTTGG - Intronic
1141858273 16:86699696-86699718 CCCTGACAGGTGGCCTCTGTGGG + Intergenic
1142499438 17:324022-324044 GCCTTACAGGGCGACTCTGAGGG - Intronic
1142639474 17:1277520-1277542 CCTTCACAGGGTGGCTAGGTGGG - Intergenic
1142807750 17:2380347-2380369 GAATCCCAGGGTGACTCTGTCGG + Exonic
1150031503 17:61741309-61741331 CCCTCATTGGATGACTCTGAGGG - Intronic
1150295655 17:64006001-64006023 CACCCAGATGGTGACTCTGTGGG + Intronic
1152128623 17:78462362-78462384 CCCTCACAGGGTGTCAATGGTGG + Intronic
1152506834 17:80755048-80755070 CCCTCCCAGGGTGTCCCTGGGGG - Intronic
1154285307 18:13050598-13050620 CCCACAGAGCGAGACTCTGTCGG - Intronic
1156296595 18:35797399-35797421 CCCTTAGAGGGAGACTGTGTTGG + Intergenic
1156850941 18:41725526-41725548 CTCTCACAGGGTGGATCTTTGGG - Intergenic
1158729803 18:60010693-60010715 CCCTCTCCGGGTGAGTCTGCTGG + Intergenic
1161101989 19:2425918-2425940 CCCCAACAGGGTGACGCTGGGGG + Exonic
1167666576 19:50825935-50825957 TCCCCACAGGGTGACTCTGGGGG - Exonic
1167693970 19:51003247-51003269 CGCGTACAGGGTGACTCTGGGGG - Exonic
1167698629 19:51029444-51029466 CCCTTCCAGGGTGATTCTGGGGG - Exonic
1167702312 19:51056762-51056784 CCAACTCAGGGTGACTCTGGGGG - Exonic
1167705317 19:51078146-51078168 CCCCCTCAGGGTGACTCTGGGGG - Exonic
926198368 2:10776875-10776897 CCCTGCCAGGGTCTCTCTGTGGG + Intronic
926611380 2:14951729-14951751 ACCTCACAGGGTGGCTTTGAAGG - Intergenic
927219443 2:20693743-20693765 AGCTCACAGGGTGAGCCTGTGGG + Intronic
927250430 2:20991269-20991291 CTGTCACAGGGTGGCTCTGGAGG - Intergenic
927653294 2:24925092-24925114 CTCTCACAGGGTCACTCCTTGGG + Intergenic
928283314 2:29967357-29967379 CCCACACACGGTGGCTGTGTGGG + Intergenic
929316380 2:40484143-40484165 CCCTCACAGGCTGTCCCTTTGGG + Intronic
938379978 2:130831179-130831201 CCCTCCCATGGTGACTGTGAGGG - Intergenic
939015946 2:136903905-136903927 ACCTCACAGGAAGACTCTGCTGG - Intronic
1168813379 20:720682-720704 CCCCTAGAGGGTGACTCTGCAGG - Intergenic
1169442143 20:5641465-5641487 CCCTCATAGGGAGGCTCTGAAGG - Intergenic
1172440322 20:34960872-34960894 CCCTCCCAGGATGACTGTGGGGG - Intergenic
1174114108 20:48215036-48215058 CCCTGACAAGGTGACACTGCAGG - Intergenic
1175987341 20:62770633-62770655 CCCTCACCTGGGGGCTCTGTGGG - Intergenic
1178849485 21:36201098-36201120 TCCACACATGGTGACTCTGTGGG - Intronic
1181046271 22:20215807-20215829 CCTGCACAGGGTGACTGTATGGG + Intergenic
1183302730 22:37066225-37066247 CCCTTTCAGGGTGACTCAGGTGG - Exonic
1184822779 22:46923273-46923295 CCCTCCCAGTGTGGCTGTGTGGG - Intronic
1185058131 22:48591849-48591871 CCCTGAGAGGGAGACTCCGTGGG - Intronic
949797896 3:7870779-7870801 ACCTCACAGATTGACTCTGTGGG - Intergenic
950167701 3:10814294-10814316 ACCTCACAGGGTGGGTGTGTGGG - Intergenic
951313987 3:21165746-21165768 CCCTCACAGGTTGCTTCTGCTGG - Intergenic
953841435 3:46392926-46392948 CCCGGACAGGGTGACTCCTTCGG - Intergenic
962643342 3:137411448-137411470 CTCTCAAAGGGAGAATCTGTAGG + Intergenic
963037754 3:141047362-141047384 GCATCACATGGTGACTCTGTAGG - Intergenic
963852496 3:150222739-150222761 TCCTCACCGAGTGACTCTTTGGG - Intergenic
965223052 3:165952489-165952511 CCATCACAGGGTTACTGTCTAGG - Intergenic
968817988 4:2831629-2831651 CCCTCACAGGCTGACACTGGCGG + Exonic
972897781 4:43644550-43644572 CCCTCATGGGGAGTCTCTGTTGG - Intergenic
973119517 4:46503154-46503176 CCCTCACACTGTTACACTGTGGG - Intergenic
980955153 4:139420440-139420462 CCCTCACAGCATCACTGTGTGGG + Intergenic
986479873 5:8176064-8176086 CCCACAGAGGCTGACTGTGTTGG + Intergenic
993558048 5:89366638-89366660 CCACCCCAGGGAGACTCTGTGGG + Intergenic
994567218 5:101465581-101465603 CCCTGTCAGGGTGCCTCTTTTGG - Intergenic
996797045 5:127358878-127358900 CTCTCACAGTGTGTCTCTATAGG - Intronic
999347951 5:150840912-150840934 CCCTTACAAGGTGTCTGTGTGGG + Intergenic
1001329472 5:170752179-170752201 GCCTCACAGGGTCACTTTCTGGG - Intergenic
1001427561 5:171633535-171633557 ACCTCACAGGGTGGCTGTGAGGG + Intergenic
1003604303 6:7545080-7545102 CCATCAAAGGGTGAATTTGTGGG + Intronic
1003810329 6:9772784-9772806 CCCTCACAGGGTTTTTGTGTAGG + Intronic
1004442865 6:15670517-15670539 CCCTTAGAGGGGGACTCTGAGGG + Intergenic
1007161907 6:39798314-39798336 CCCTCATAGGATGACTGTGAGGG + Intronic
1007218170 6:40257311-40257333 CCCTCACAGGATGGCTGTGATGG + Intergenic
1007731863 6:43952208-43952230 CCCCTACAGGGTGCCTCTGCTGG - Intergenic
1011031977 6:82933134-82933156 CCTTCACAGTATGACTCTCTAGG + Intronic
1012869942 6:104660177-104660199 CCATCAAAGGATCACTCTGTGGG + Intergenic
1013601356 6:111708160-111708182 CCTTCACAGGGGGACTATGTTGG - Intronic
1016908113 6:149171182-149171204 ACCTCCTAGGGTGACTCTGCTGG - Intergenic
1018389988 6:163334986-163335008 ACCTCAGAAGGTGACCCTGTTGG + Intergenic
1020810953 7:12849228-12849250 CCCTCATAGGCTGACACTGTGGG + Intergenic
1024809058 7:53185430-53185452 CACTCACAGGATGAGACTGTGGG + Intergenic
1025264093 7:57441105-57441127 CACTCACCTGGTGACTCTGATGG + Intergenic
1026495621 7:70899620-70899642 CCCTCCCAGGGTGAATGAGTAGG + Intergenic
1027684919 7:81267728-81267750 CCAGCACAGCGTGACTCAGTGGG - Intergenic
1029532081 7:101132140-101132162 CCCTCAGAGGGTGACATTTTGGG - Intronic
1034934195 7:155187943-155187965 CCCACACTGGGTGTCCCTGTTGG + Intergenic
1037635952 8:20701187-20701209 ACCTTACAGGGTGCCTCTGCCGG + Intergenic
1038849951 8:31266009-31266031 CCCTGACAGACTGACTCCGTGGG + Intergenic
1040359504 8:46651806-46651828 CCCTCACAAGCTGGCACTGTGGG - Intergenic
1040694820 8:49983682-49983704 CCCTCTCTGGGGGCCTCTGTTGG - Intronic
1042758892 8:72250107-72250129 GCCTCCCAAGGTGAGTCTGTTGG - Intergenic
1042945102 8:74146437-74146459 CCAACACAGGGCGACTCTGATGG - Intergenic
1048006345 8:130422297-130422319 CCCTCACCAGGTGACTGTGATGG - Intronic
1048343689 8:133560424-133560446 CCATCACTGGGTGAGTCCGTGGG - Intronic
1051365427 9:16318393-16318415 TCCTCACAGGAAGACTCTGAGGG - Intergenic
1053313403 9:37033904-37033926 CCCACGCAGGGTGACCCTGGAGG - Intronic
1054775741 9:69122035-69122057 GCCTCACAGGGTCTCTCTGGGGG + Intronic
1055404196 9:75957286-75957308 GCTTCTCAGGGTGACTATGTGGG + Intronic
1056111835 9:83403910-83403932 CCTTCACAGGGTGGAGCTGTGGG - Intronic
1058686454 9:107485606-107485628 CACTCACAAGATGACTCAGTTGG + Exonic
1060279664 9:122207272-122207294 CCCTCCCAGGGAGACTATGAAGG + Intronic
1060536417 9:124392525-124392547 TCCTCAAAGGGTGGCTCTGAGGG + Intronic
1061773480 9:132945071-132945093 CCCTCCGAGGGTCTCTCTGTGGG + Intergenic
1062043574 9:134415143-134415165 CCCACACAGGGAGACTCAGGCGG - Intronic
1062503958 9:136863350-136863372 CCATGACAGGGTGACCCTGGAGG - Exonic
1062530200 9:136996322-136996344 CCCTCTCTGGGTGACTCGCTGGG + Intronic
1187244462 X:17541414-17541436 ACCTCACAGGGTGATTGTGAAGG + Intronic
1190222332 X:48520512-48520534 CCCTCTCAGGGTGCCACTGATGG + Exonic
1190641001 X:52482691-52482713 GCCTCAGAGGGTGACTCGGGAGG - Intergenic
1190646671 X:52530174-52530196 GCCTCAGAGGGTGACTCGGGAGG + Intergenic
1194120944 X:89962863-89962885 CCCTCATAGGATGACTTTGAGGG + Intergenic
1196328905 X:114444314-114444336 GCCTCACAGAATGAGTCTGTAGG + Intergenic
1200473807 Y:3620368-3620390 CCCTCATAGGATGACTTTGAGGG + Intergenic
1201488050 Y:14512500-14512522 CCCTCACAGGGGAACTCTCTAGG - Intergenic