ID: 907268060

View in Genome Browser
Species Human (GRCh38)
Location 1:53274806-53274828
Sequence CCTCACAGGGTGACTCTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 311}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907268048_907268060 23 Left 907268048 1:53274760-53274782 CCGCCGTCCACGCGCTTGCCACT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 907268060 1:53274806-53274828 CCTCACAGGGTGACTCTGTTGGG 0: 1
1: 0
2: 0
3: 26
4: 311
907268051_907268060 5 Left 907268051 1:53274778-53274800 CCACTCTTACACTGAAATCTGCG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 907268060 1:53274806-53274828 CCTCACAGGGTGACTCTGTTGGG 0: 1
1: 0
2: 0
3: 26
4: 311
907268050_907268060 16 Left 907268050 1:53274767-53274789 CCACGCGCTTGCCACTCTTACAC 0: 1
1: 0
2: 0
3: 0
4: 33
Right 907268060 1:53274806-53274828 CCTCACAGGGTGACTCTGTTGGG 0: 1
1: 0
2: 0
3: 26
4: 311
907268049_907268060 20 Left 907268049 1:53274763-53274785 CCGTCCACGCGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 907268060 1:53274806-53274828 CCTCACAGGGTGACTCTGTTGGG 0: 1
1: 0
2: 0
3: 26
4: 311
907268047_907268060 24 Left 907268047 1:53274759-53274781 CCCGCCGTCCACGCGCTTGCCAC 0: 1
1: 0
2: 1
3: 0
4: 53
Right 907268060 1:53274806-53274828 CCTCACAGGGTGACTCTGTTGGG 0: 1
1: 0
2: 0
3: 26
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907268060 Original CRISPR CCTCACAGGGTGACTCTGTT GGG Intronic
900482848 1:2907756-2907778 CCTCAGACTGTAACTCTGTTTGG + Intergenic
900931205 1:5739023-5739045 CCTCACAGTGTGACTCTGGATGG - Intergenic
901102680 1:6731413-6731435 CCTCAGATTGTGACTCTATTTGG + Intergenic
902699986 1:18165499-18165521 CCTCAGAATGTGACTGTGTTTGG - Intronic
902791066 1:18768483-18768505 CATCACTGTGTGTCTCTGTTAGG - Intergenic
905485570 1:38293394-38293416 CCTCAGAAGGTGACTGTGTTTGG - Intergenic
906645200 1:47469865-47469887 CAGCCCAGGGTGACTCTGTTGGG - Intergenic
907246526 1:53112735-53112757 CCCCTCTGGGTGACCCTGTTGGG - Intronic
907268060 1:53274806-53274828 CCTCACAGGGTGACTCTGTTGGG + Intronic
908839464 1:68264138-68264160 CCTCTCTGTGTGCCTCTGTTGGG - Intergenic
909955500 1:81773832-81773854 CCTCAGAGTGTGACTGTATTTGG + Intronic
910095329 1:83515181-83515203 CCTCAGAATGTGACTATGTTTGG - Intergenic
910551555 1:88481232-88481254 CCTCACAATGTGACTCTATTTGG + Intergenic
910751595 1:90637075-90637097 CCTCACAGGTTGACCATATTTGG - Intergenic
911866942 1:103039397-103039419 CCTCACATTGTGACTGTATTTGG + Intronic
916334014 1:163649498-163649520 CCTCACAAGGTGACTGTATTTGG - Intergenic
916876338 1:168973513-168973535 CAACACAGGCTGACACTGTTGGG + Intergenic
916899222 1:169202526-169202548 CCTCACTGAGTTACTGTGTTAGG - Intronic
919730116 1:200908483-200908505 CCTCCCAGATTGACTCTCTTGGG - Intronic
919901773 1:202049049-202049071 CCTTCCAGGGTGCCTGTGTTAGG - Intergenic
920103793 1:203535905-203535927 CCTCAGAATGTGACTCTATTTGG + Intergenic
920648096 1:207817984-207818006 CCTCCCAGGGTGACTCATTTGGG - Intergenic
922810109 1:228410586-228410608 CCTCAGAATGTGACTGTGTTTGG + Intronic
922854973 1:228767342-228767364 CCTCAGAGTATGACTCTATTTGG + Intergenic
924388162 1:243520118-243520140 CCTCAGAATGTGACTCTATTTGG + Intronic
1062957662 10:1551022-1551044 CCTCAGAAGGTGACAGTGTTTGG + Intronic
1063130940 10:3175929-3175951 TCTCAGAGTGTGACTTTGTTTGG + Intergenic
1063228960 10:4044939-4044961 CCTCAGAGTGTGACTATATTTGG - Intergenic
1063232646 10:4080846-4080868 CCTCACAAAGTGACTGTATTTGG - Intergenic
1064338764 10:14467982-14468004 CCTCCCAGGGAGACTCTGAGAGG + Intergenic
1065436616 10:25709449-25709471 CCTCAGAGTGTGACTGTATTTGG - Intergenic
1065545246 10:26812836-26812858 CCTCAGAGTGTGACTGTATTTGG - Intronic
1065757555 10:28947335-28947357 CCTAACAGAGAGACTTTGTTTGG + Intergenic
1067835871 10:49641213-49641235 GCTCTCAGTGTGACTCTATTTGG - Intronic
1067908288 10:50317470-50317492 TCACACAGAGTGACTCAGTTGGG + Intronic
1068217396 10:53999993-54000015 CCAGACAGAGTGTCTCTGTTTGG - Intronic
1071088690 10:81894525-81894547 CCTCAAAAGGTGACTGTATTTGG - Intronic
1076534204 10:131166561-131166583 GCTCCCTGGGGGACTCTGTTGGG - Intronic
1077101754 11:825592-825614 CCTCACACGGTGACACAGTGGGG + Intergenic
1077301788 11:1850783-1850805 CCTCAGAGCGTGACCGTGTTTGG - Intergenic
1077438480 11:2556285-2556307 CCTCAGAGTGTGACCTTGTTTGG - Intronic
1078319238 11:10318844-10318866 CCTCAGAATGTGACTGTGTTTGG + Intronic
1080253308 11:30260106-30260128 CCTCAGAATGTGACTGTGTTTGG + Intergenic
1080839552 11:35971370-35971392 CCTCAGAAGGTGACTGTATTTGG + Intronic
1082715527 11:56606993-56607015 CCTTTCAGTGTGACACTGTTTGG + Intergenic
1082808509 11:57464527-57464549 GATCAGAGGGTGACTCTGATAGG + Intronic
1084068509 11:66719066-66719088 CCTCTCTGGGTGACTCTGGGAGG + Intronic
1084779585 11:71399614-71399636 CCTCAGAGTGTGACTGTGCTTGG - Intergenic
1085601245 11:77858046-77858068 CCTCACAGGGTGACCCAGGCTGG + Intronic
1087081384 11:94174202-94174224 CCTCAGAGTGTGATACTGTTTGG - Intronic
1089393388 11:118117297-118117319 TCTCACAGGGTGACAGTGGTGGG + Exonic
1089595486 11:119576471-119576493 CCTCACAGTGTGACCTTATTTGG - Intergenic
1090419846 11:126567167-126567189 CCTCAGAGTGTGACCTTGTTTGG + Intronic
1091043410 11:132303551-132303573 CCTCAGAGAGTGACTATATTTGG - Intronic
1093347184 12:18052660-18052682 ACTCTCAGAGTGACTCTTTTTGG - Intergenic
1094132007 12:27084696-27084718 CCTGCCAGGCTGCCTCTGTTGGG - Intergenic
1096542404 12:52315123-52315145 CCTCACAGCCTGAATGTGTTGGG - Intronic
1098338874 12:69431399-69431421 CCTCAGAGTGTGACTTTATTTGG + Intergenic
1100501514 12:95179031-95179053 TGTCTCTGGGTGACTCTGTTAGG + Intronic
1101207926 12:102507430-102507452 CCTCACAGGGTGATATGGTTTGG + Intergenic
1101833246 12:108275650-108275672 CATCACAGTGTGACTTTCTTTGG - Intergenic
1102890070 12:116551904-116551926 CCTCAGAATGTGACTTTGTTGGG - Intergenic
1103128610 12:118446869-118446891 CCTCAAAGTGTGACTGTATTTGG - Intergenic
1103249225 12:119485726-119485748 CCTCAGCGTGTGACTGTGTTAGG - Intronic
1104649728 12:130522822-130522844 GCCCCCAGGGTGACTCTATTTGG + Intronic
1106171746 13:27294614-27294636 CCTCAGAATGTGACTGTGTTTGG + Intergenic
1106859361 13:33888340-33888362 CCTCACATGGTGCCTCTTCTGGG + Intronic
1107437029 13:40389249-40389271 CCTCACAGGGGGCCTCTGAAGGG - Intergenic
1107524088 13:41213386-41213408 CAGCACAGAGAGACTCTGTTTGG - Intergenic
1108246320 13:48517828-48517850 CCTCAGAAGGTGATTTTGTTTGG + Intronic
1108387183 13:49910321-49910343 CCTGGCAGGGAGACACTGTTGGG - Intergenic
1109554528 13:63955006-63955028 CAGCACAGAGAGACTCTGTTTGG - Intergenic
1110008390 13:70300377-70300399 CCTCAGAATGTGACTCTATTTGG - Intergenic
1110521190 13:76478677-76478699 CCTCAGAATGTGACTATGTTTGG - Intergenic
1111052945 13:82908978-82909000 CCTCAGAATGTGACCCTGTTTGG - Intergenic
1111578058 13:90184427-90184449 CCTCAGAATGTGACTGTGTTTGG - Intergenic
1112101836 13:96197955-96197977 CCTCACAGAGAACCTCTGTTAGG - Intronic
1112617210 13:101017895-101017917 CCTCAGAATGTGACTGTGTTTGG - Intergenic
1112857194 13:103786441-103786463 CCTCATGGGGAAACTCTGTTAGG - Intergenic
1113037160 13:106062773-106062795 CCTCAGACTGTGACTGTGTTTGG + Intergenic
1113132830 13:107057189-107057211 GTTCACTGGGTGTCTCTGTTTGG - Intergenic
1113529534 13:111011994-111012016 CCTCACAGTGTGACTTTGTAGGG + Intergenic
1113659606 13:112096581-112096603 CCTCACAGGATGACTCCGGGGGG - Intergenic
1115790300 14:36870628-36870650 CCTCAGAAGGTGACTTTATTTGG - Intronic
1116999836 14:51361253-51361275 CCTCACAATGAGACTCTGATAGG - Intergenic
1119105039 14:71915766-71915788 CCTCAGAATGTGACTGTGTTTGG + Intergenic
1121026508 14:90620342-90620364 CCGCTCAGGGTGCCTCTGTGGGG + Intronic
1121108335 14:91295481-91295503 CCACACAGGGTCTTTCTGTTGGG - Intronic
1121221143 14:92286407-92286429 CCTCACAATGTGACTGTATTTGG - Intergenic
1121467784 14:94127200-94127222 CCTCACTGTGTGAGGCTGTTTGG - Intergenic
1122390017 14:101373735-101373757 CCTCAGAGGGTGACCTTATTTGG - Intergenic
1122536306 14:102465971-102465993 CCCCATTTGGTGACTCTGTTGGG + Intronic
1123849806 15:24343188-24343210 CCTAGCAGGGTCACTCTTTTTGG - Intergenic
1125066656 15:35495156-35495178 CCTCAGATGGTGACTGTATTTGG + Intronic
1126516212 15:49540660-49540682 CCTCACAATGTGACTGTATTTGG - Intronic
1126585931 15:50287410-50287432 CCTCAAAGTGTGACTCTATTTGG + Intronic
1128317897 15:66672601-66672623 CCTCAGAGTGTGACTATATTTGG - Intronic
1128364600 15:66988801-66988823 CAACACAGAGAGACTCTGTTTGG + Intergenic
1130994533 15:88896507-88896529 CCGCTCAGGATGCCTCTGTTTGG + Intergenic
1131346597 15:91655392-91655414 CCTCAGAGTGTGACTATTTTTGG + Intergenic
1131981503 15:97999098-97999120 CCTCAGATTGTGACTGTGTTTGG + Intergenic
1132607902 16:801095-801117 CCACACAGGATGCCTCTGTCAGG - Intergenic
1132708997 16:1258324-1258346 CTTCCCAGGGTGACTCTGGAGGG + Exonic
1133378818 16:5312910-5312932 TCTCACATGGTGCCTCTGTTTGG + Intergenic
1133542605 16:6770991-6771013 CCTCAGAATGTGAGTCTGTTTGG + Intronic
1133587292 16:7208268-7208290 CCTCACAATGTGACTGTATTTGG + Intronic
1134435398 16:14252015-14252037 CCTCACAGGGTTACCTTGTTGGG - Exonic
1137709234 16:50555071-50555093 CCTCCCAGAGTGCCTCTGTGTGG - Intronic
1138084284 16:54119548-54119570 CCTCTCAGCGTGACCCTGGTTGG - Exonic
1140657916 16:77159063-77159085 CCTCAGAAGGTGACTTTATTTGG - Intergenic
1140815657 16:78618571-78618593 CCTCACAATGTGACTGTGTTTGG - Intronic
1141301987 16:82825559-82825581 CAACAGAGGGAGACTCTGTTTGG - Intronic
1142807751 17:2380348-2380370 AATCCCAGGGTGACTCTGTCGGG + Exonic
1143502842 17:7348987-7349009 CCTCAGAGGGGGGCTCTGTTCGG - Exonic
1143782637 17:9237426-9237448 CTTCACAGGGTGACTTTACTTGG - Intronic
1149650610 17:58273830-58273852 CCTCTCAGTGCCACTCTGTTAGG - Intronic
1150656529 17:67043455-67043477 GCTCACAGGGTGGCCCTTTTTGG - Intergenic
1150838774 17:68588752-68588774 CCTCAGAATGTGACTGTGTTTGG - Intronic
1151852108 17:76697097-76697119 CCTCTCAGCCTGACTCTATTTGG + Intronic
1152128625 17:78462363-78462385 CCTCACAGGGTGTCAATGGTGGG + Intronic
1152177096 17:78794986-78795008 CGACAGAGGGAGACTCTGTTCGG + Intronic
1152263550 17:79280309-79280331 CCTCAGAGGGTGGGTGTGTTGGG - Intronic
1155433086 18:25782358-25782380 CCTCAGAGTGTGACTGTATTTGG - Intergenic
1156296597 18:35797400-35797422 CCTTAGAGGGAGACTGTGTTGGG + Intergenic
1156552328 18:38030546-38030568 CCTCCCAGTGTGACTGTATTTGG - Intergenic
1157690744 18:49679833-49679855 CCTCAAAATGTGACTGTGTTTGG + Intergenic
1160028954 18:75241996-75242018 CCTCACAATGTGACTTTGTTTGG - Intronic
1160533818 18:79580719-79580741 CATCACAGGGTGACATGGTTCGG - Intergenic
1161259875 19:3331929-3331951 CCTCAGAAGGTGACTTTATTAGG - Intergenic
1164761152 19:30729298-30729320 CCTAACGTGGTCACTCTGTTTGG - Intergenic
1167606604 19:50484499-50484521 GCTGGCAGGGTTACTCTGTTGGG + Exonic
925072955 2:985516-985538 CCTCCCAGGGTGTCTCTGCCTGG - Intronic
925975403 2:9138737-9138759 CACCACAGGGTGTCGCTGTTAGG + Intergenic
926088748 2:10036530-10036552 TCTCACAGGGTGACTTGGTGTGG - Intergenic
926809403 2:16743017-16743039 CCTCAGAGTATGACTGTGTTTGG + Intergenic
928472339 2:31586547-31586569 ACTGACAGAGGGACTCTGTTTGG + Intergenic
929029810 2:37639846-37639868 CCTCAAAGGGTTTCTTTGTTGGG + Intergenic
929441231 2:41967074-41967096 TCACACAGGGTGCCTTTGTTAGG + Intergenic
929836621 2:45407168-45407190 CCTCACAGGGTTGCTGTGTGAGG + Intronic
930177583 2:48315455-48315477 CCTCAGAGGGTGGCTGTCTTGGG + Intronic
930575919 2:53148781-53148803 CCTCAGAATGTGACTCTATTTGG + Intergenic
933212573 2:79587691-79587713 CCACTCAGGGTGACGCTGCTAGG + Intronic
935111123 2:100095075-100095097 ACTCAGAGGTTTACTCTGTTGGG - Intronic
936123852 2:109770087-109770109 ACTCAGAGGTTTACTCTGTTGGG + Intergenic
936220836 2:110601377-110601399 ACTCAGAGGTTTACTCTGTTGGG - Intergenic
938920836 2:135993167-135993189 TCTCAGAAGGTGACTGTGTTTGG + Intergenic
939015944 2:136903904-136903926 CCTCACAGGAAGACTCTGCTGGG - Intronic
941489136 2:166121834-166121856 CCTCAGAATGTGACTGTGTTAGG + Intronic
942367073 2:175239141-175239163 CCTCACAGAGAGCCTCTGCTAGG - Intergenic
944161144 2:196661543-196661565 CCTCACAATGAGACTCTATTTGG - Intronic
944269061 2:197760456-197760478 CCCCACAGGCTGCCTCTGGTGGG + Intronic
944306067 2:198181296-198181318 CCTCAGAATGTGACTGTGTTAGG - Intronic
946984829 2:225259054-225259076 ACTCAGAGAGAGACTCTGTTTGG + Intergenic
947499630 2:230662494-230662516 CCTCACAATGTGACTGTATTTGG - Intergenic
948524816 2:238564955-238564977 CCTCAGAGTGTGACTGTATTTGG + Intergenic
948665274 2:239530658-239530680 GCTCACAGGGGGGCTCTGATGGG + Intergenic
1168963747 20:1886465-1886487 CCCCACAGGGTGACTGAGATGGG - Intergenic
1169374638 20:5056709-5056731 CCTCAGAATGTGACTCTATTTGG - Intergenic
1169850955 20:10049999-10050021 CCATTCAGGATGACTCTGTTTGG + Exonic
1169942066 20:10947942-10947964 TCTCTCTGGGTGACTCTGTGAGG + Intergenic
1169974061 20:11303658-11303680 CTTCACAGTGTGACGCAGTTTGG + Intergenic
1170236688 20:14114226-14114248 GCTCACATTCTGACTCTGTTTGG + Intronic
1170835579 20:19881604-19881626 CCAGACTGGGTGACTCTGTGAGG - Intergenic
1171203866 20:23264407-23264429 CCTCAGAGTGTGACTGTATTTGG - Intergenic
1171502427 20:25604031-25604053 CCCCACAGGGTGGCTGTGTCAGG + Intergenic
1175821052 20:61909040-61909062 CCTCAGAGTGTGACTGTATTTGG - Intronic
1175987365 20:62770696-62770718 CCTCACCTGGGGACTCTGTGAGG - Intergenic
1176427146 21:6555245-6555267 CCTCAGAGTGTGACTGTATTTGG - Intergenic
1178032080 21:28539453-28539475 CCTCACAACGTGACATTGTTTGG + Intergenic
1178666348 21:34550378-34550400 CCTCACAATGTGACTGTATTTGG + Intronic
1179164757 21:38926658-38926680 GCTCAGAATGTGACTCTGTTTGG + Intergenic
1179502760 21:41820374-41820396 CTTCACAATGTGACTATGTTTGG + Intronic
1179702637 21:43163563-43163585 CCTCAGAGTGTGACTGTATTTGG - Intergenic
1181105508 22:20572417-20572439 CCTGACAGGGCGCCTCTCTTCGG - Intronic
1182684536 22:32111428-32111450 TCTCACAGTGTGACTGTATTTGG - Exonic
1183275699 22:36896179-36896201 CCTCACAGGGAAACTCTACTAGG + Intergenic
1183629863 22:39026421-39026443 CCTCACAGGATAACTGTATTTGG - Intronic
1183633305 22:39046280-39046302 CCTCACAGGATAACTGTATTTGG - Intronic
1183639108 22:39082656-39082678 CCTCAAAGGGTGGCTGTATTTGG - Intronic
1184130745 22:42515164-42515186 CTTCACAGGGTGGCTCTCTGTGG + Exonic
1184140924 22:42576994-42577016 CTTCACAGGGTGGCTCTCTGTGG + Intergenic
1184800849 22:46758276-46758298 GGTCACAGGATGCCTCTGTTGGG - Intergenic
1185092973 22:48786292-48786314 CCCCAGAGGGTGGCTCTGTGAGG - Intronic
949128387 3:472777-472799 CCTCAGAATGTGACTATGTTTGG - Intergenic
950166806 3:10807065-10807087 CCTGAGAGTGTGACTGTGTTTGG - Intergenic
950535102 3:13574102-13574124 CTCAACACGGTGACTCTGTTAGG - Intronic
951313985 3:21165745-21165767 CCTCACAGGTTGCTTCTGCTGGG - Intergenic
951437815 3:22685441-22685463 CCTCAGAATGTGACTGTGTTTGG - Intergenic
951932627 3:27985775-27985797 CCTCACACTGTGACTGTATTTGG + Intergenic
952122205 3:30258983-30259005 ACCCACAGGGTGCCTCTCTTAGG - Intergenic
952660986 3:35846471-35846493 CCTCAAAATGTGACCCTGTTGGG - Intergenic
954578258 3:51688749-51688771 CCTCACAGGCTCACTATATTCGG - Intronic
954752296 3:52820508-52820530 TCTCCCAGGGGGAGTCTGTTGGG + Intronic
954855952 3:53643574-53643596 CTTCACAGGGAGGCTCTGTGAGG - Intronic
955900490 3:63748458-63748480 CCTCAGAGTGTGACTGTATTTGG + Intergenic
956142761 3:66162285-66162307 CCTCAGAATGTGACTCTATTTGG - Intronic
956707312 3:72010547-72010569 CCTCACAGGGTGCCACTGCCAGG + Intergenic
958979582 3:100705767-100705789 CCTCAAAAGGTGACTGTATTTGG - Intergenic
959175845 3:102909139-102909161 CCTCAGAATGTGACTTTGTTTGG - Intergenic
959713924 3:109412566-109412588 CCTCACAAGGTAACTGTATTTGG - Intergenic
960207208 3:114917716-114917738 TCACACAGAGAGACTCTGTTTGG - Intronic
961399149 3:126622794-126622816 CCTCCAAGGGTGACTATATTTGG + Intronic
961952414 3:130763272-130763294 ACACAGAGGGAGACTCTGTTAGG + Intergenic
963003610 3:140705816-140705838 CCTCACAGAGAGACTCTACTAGG - Intergenic
963037753 3:141047361-141047383 CATCACATGGTGACTCTGTAGGG - Intergenic
966617915 3:181931900-181931922 CCTCAGAATGTGACTTTGTTTGG + Intergenic
966774213 3:183529818-183529840 CCCCGCAGTGTGACTCTATTTGG + Intronic
967226391 3:187295672-187295694 CTTCAGAAGGTGACTGTGTTTGG + Intergenic
968680472 4:1915485-1915507 GCACACAGGGTTTCTCTGTTGGG + Intronic
968817990 4:2831630-2831652 CCTCACAGGCTGACACTGGCGGG + Exonic
968955368 4:3716293-3716315 CCCCACAGGGTGACCTTATTTGG + Intergenic
969045289 4:4332083-4332105 CCTCAGAATGTGACCCTGTTTGG + Intergenic
969077282 4:4590093-4590115 CCTCAATAGGTGACTTTGTTTGG - Intergenic
969376431 4:6766498-6766520 GGTCACAGGGTGACTGTGCTGGG + Intergenic
970160029 4:13178952-13178974 CCTCACAGTATGACTCTGGTAGG + Intergenic
970316987 4:14838670-14838692 CCTCAGAATGTGACTGTGTTTGG + Intergenic
972897779 4:43644549-43644571 CCTCATGGGGAGTCTCTGTTGGG - Intergenic
973553307 4:52056763-52056785 GGTCACAGGGTGAGTCTGGTGGG - Intronic
973834070 4:54791765-54791787 CCTCAGAAGGTGACTGTATTTGG - Intergenic
977647781 4:99433560-99433582 CCTCAGAAGGTGACTGTATTTGG + Intronic
977895562 4:102360999-102361021 CCTCAGAATGTGACTCTATTTGG + Intronic
980961602 4:139481378-139481400 CCTCAGAATGTGACTTTGTTTGG - Intergenic
981130476 4:141153269-141153291 CCACAGATGGTGACTGTGTTTGG + Intronic
983039317 4:162906352-162906374 CCTCACAGAGAACCTCTGTTAGG - Intergenic
984356759 4:178669984-178670006 CCTCAGAAGGTGACAGTGTTTGG - Intergenic
985596612 5:794536-794558 CCTCATAGGGTATCTCTGTGAGG - Intergenic
985903291 5:2813770-2813792 CCTCAGAGGCTGACCCTGCTTGG + Intergenic
985966978 5:3345002-3345024 CCTCACAAAGTGTCTCTGGTGGG - Intergenic
986215290 5:5713725-5713747 CCTGACAGGGTCACTGGGTTGGG - Intergenic
986297839 5:6454462-6454484 CCTCAGAGGGTGACCTTATTTGG - Intronic
986831768 5:11588219-11588241 CTTCACATGGTGACTCTGGTTGG + Intronic
986902344 5:12452011-12452033 CCTCAGAATGTGACTGTGTTTGG + Intergenic
987609547 5:20184593-20184615 CACCACAGGGTGATTCTGTTAGG + Intronic
989482134 5:41943805-41943827 CCTCACAATGTGACTGTATTTGG + Intergenic
991355738 5:65767191-65767213 CCTCACAGAGAACCTCTGTTAGG - Intronic
992358210 5:76007895-76007917 GCTGACAGGGAGATTCTGTTAGG + Intergenic
994587561 5:101729223-101729245 CCTCACAGGGTAACTCAATGAGG - Intergenic
996263251 5:121500729-121500751 CCTCAGAATGTGACTGTGTTTGG + Intergenic
996371486 5:122757809-122757831 CCTCACAATGTGACACTATTTGG + Intergenic
996592103 5:125159557-125159579 TCTCACAGGATGGCTGTGTTTGG + Intergenic
998659166 5:144216822-144216844 CCACAGAGGGAGACTCTGTCTGG + Intronic
1001419950 5:171578879-171578901 CCAGCCAGGGTGACTCTATTTGG - Intergenic
1003136114 6:3435751-3435773 CCTCAAAATGTGACCCTGTTTGG + Intronic
1003150460 6:3543522-3543544 CCTCAGAGAGTGACTGTATTTGG - Intergenic
1003399670 6:5781487-5781509 CCTCAGAGTGTGACTGTGTTTGG + Intergenic
1004135521 6:12962319-12962341 CCTCAGAATGTGACTCTATTTGG - Intronic
1004299830 6:14447175-14447197 CCTCAAAATGTGACTCTATTTGG - Intergenic
1007309154 6:40931656-40931678 CCTCAGAGTGTGACTATATTTGG + Intergenic
1008189612 6:48438815-48438837 CCTCACAGAGAGTCTCTGCTAGG + Intergenic
1009322680 6:62311927-62311949 CCTCAGAATGTGACTCTATTTGG + Intergenic
1011504648 6:88028298-88028320 CCTCACAGAGAGCCTCTGCTAGG - Intergenic
1013719168 6:113001863-113001885 CTTCACAGCGTGTCTCAGTTTGG - Intergenic
1013829531 6:114255552-114255574 CCTCACAGAGAACCTCTGTTAGG - Intronic
1014216554 6:118757388-118757410 CCTCAGAGTGTGACTGTATTTGG - Intergenic
1014629399 6:123770782-123770804 CCTCACAGGCGGGCTGTGTTTGG - Intergenic
1015864535 6:137714381-137714403 AGACACAGGGTGACACTGTTTGG - Intergenic
1016764048 6:147772795-147772817 CCTCAGAAGGTGACTGTATTTGG - Intergenic
1016908111 6:149171181-149171203 CCTCCTAGGGTGACTCTGCTGGG - Intergenic
1018389990 6:163334987-163335009 CCTCAGAAGGTGACCCTGTTGGG + Intergenic
1018603311 6:165570065-165570087 CCTCAGAATGTGACTCTGTGTGG + Intronic
1019554969 7:1624805-1624827 CCTCAGAATGAGACTCTGTTTGG - Intergenic
1019791277 7:3015543-3015565 CCTCACAATGTGACTGTATTTGG - Intronic
1021310791 7:19093480-19093502 CCTCACAATGTGACTATATTTGG + Intronic
1022478103 7:30725051-30725073 CCTCACAGTGGGACCCTGTTTGG + Intronic
1022532937 7:31078400-31078422 CCTCCCAGGGTGCTTCTGTGAGG + Intronic
1022654305 7:32305014-32305036 GCTCACAGGGTGATACTTTTGGG - Intergenic
1023378760 7:39585303-39585325 CCTCAGAAGGTGACTGTATTTGG + Intronic
1023535962 7:41211335-41211357 CCTCACAATGTGACTTTATTTGG + Intergenic
1026105296 7:67416307-67416329 CCTCAAAATGTGACTATGTTTGG - Intergenic
1026507018 7:70993605-70993627 CCTCAGAATGTGACTTTGTTTGG - Intergenic
1027661985 7:80998195-80998217 CGTGACAGGGTAACTCTGATCGG + Intergenic
1029375016 7:100171945-100171967 CCCCCCAGGGTGACTGTGTGAGG - Intronic
1030951983 7:115802205-115802227 CCTTAGAATGTGACTCTGTTTGG + Intergenic
1031254947 7:119435468-119435490 CCTCACAGAGAACCTCTGTTAGG - Intergenic
1034490336 7:151389894-151389916 CCTCACAGGGTTTCTGGGTTGGG + Intronic
1034569993 7:151947799-151947821 CCTCAGAATGTGACTGTGTTTGG - Intergenic
1034623093 7:152471466-152471488 CCTCACAGAGAACCTCTGTTAGG + Intergenic
1034934197 7:155187944-155187966 CCACACTGGGTGTCCCTGTTGGG + Intergenic
1035116783 7:156531568-156531590 CTTCAGAAGGTGACTGTGTTTGG - Intergenic
1035394183 7:158524654-158524676 CCTCAGAAGGTGACTGCGTTTGG + Intronic
1036625418 8:10467289-10467311 CCCCACATGGTGACTGTTTTGGG + Intergenic
1036982139 8:13481740-13481762 CCTCACAATGTGACTTTATTTGG + Intronic
1037536247 8:19827309-19827331 CCTCAGAGGGAGACTCGTTTGGG - Intronic
1037635954 8:20701188-20701210 CCTTACAGGGTGCCTCTGCCGGG + Intergenic
1037861241 8:22407049-22407071 CCTCCCAAGGTGACTGTGTGTGG + Intronic
1038132583 8:24749689-24749711 TCTTACAGGGTAACTGTGTTAGG + Intergenic
1038348538 8:26755304-26755326 CCTGACAGAGTGACCATGTTTGG - Intronic
1038416911 8:27403723-27403745 CCACACAGGGCGGCTCTCTTTGG + Intronic
1038883929 8:31641829-31641851 CATCACAGGCAGACTCTGCTTGG - Intronic
1039066934 8:33617283-33617305 CTTTACAGGCTGACTTTGTTAGG + Intergenic
1041391190 8:57348882-57348904 TGTCACAGGGTGTCTCTGTAAGG - Intergenic
1041723161 8:60994315-60994337 CCTCAGAGTGTGACTGTATTTGG - Intergenic
1042945101 8:74146436-74146458 CAACACAGGGCGACTCTGATGGG - Intergenic
1045176892 8:99735298-99735320 CCTCAGAGTGTGACTTTATTTGG + Intronic
1045646922 8:104308300-104308322 CCTCACAATGTGACTATATTTGG + Intergenic
1047760150 8:127948549-127948571 CCTCAGAACGTGACTGTGTTCGG + Intergenic
1047786076 8:128154922-128154944 CTTCAGAATGTGACTCTGTTTGG - Intergenic
1048402943 8:134088660-134088682 CCTCACAGGGTGTCTTGTTTAGG + Intergenic
1048607591 8:135985766-135985788 CCTCAGAAGGTGACTTTATTTGG + Intergenic
1049606098 8:143529873-143529895 CCTGCCTGGGTGACTCTTTTGGG - Intronic
1051306836 9:15718617-15718639 CAGCACAGAGAGACTCTGTTTGG + Intronic
1052120880 9:24714641-24714663 CCTCACAGAGAAACTCTGCTAGG - Intergenic
1053010543 9:34630400-34630422 CCTCACAGTGTCCCTCTGTTTGG - Intergenic
1056179590 9:84069204-84069226 CCTCAGAATGTGACTGTGTTTGG - Intergenic
1056598447 9:88026857-88026879 CCTCAGAAGGTGACTATATTTGG - Intergenic
1056813142 9:89779981-89780003 TCCCACAGGGAGACTCTGGTGGG + Intergenic
1056957834 9:91096691-91096713 CCTCAGAATGTGACTGTGTTTGG - Intergenic
1058529377 9:105890512-105890534 CCTCCCAAGGTGACTATATTTGG + Intergenic
1058686455 9:107485607-107485629 ACTCACAAGATGACTCAGTTGGG + Exonic
1061348299 9:130043584-130043606 CCTCCCGGGCTGACTCTGCTCGG - Intergenic
1062001564 9:134218482-134218504 CCTCACAAGGTGGCTGTGCTAGG + Intergenic
1185606232 X:1368554-1368576 CCTCAGAATGTGACTGTGTTTGG + Intronic
1185726218 X:2424018-2424040 CCTCAGAATGTGACTGTGTTTGG + Intronic
1185790231 X:2923749-2923771 CCTCAGACTGTGACTCTATTTGG - Intronic
1185794142 X:2950353-2950375 CCTCAGAATGTGACTGTGTTTGG + Intronic
1185986897 X:4845067-4845089 CCTCAGAGTGTGACTGTGTTTGG + Intergenic
1186043638 X:5509236-5509258 CCTCAGAATGTGACTGTGTTTGG + Intergenic
1187288536 X:17930138-17930160 CCTCACAGGGTCACCCAGTGAGG - Intergenic
1187288537 X:17930138-17930160 CCTCACTGGGTGACCCTGTGAGG + Intergenic
1187973589 X:24683089-24683111 CCTCACAGTGAGAATCTGGTGGG - Intergenic
1188113785 X:26220719-26220741 CCTCAGAATGTGACTCTATTTGG - Intergenic
1188238234 X:27754520-27754542 CCTCACAGGGAGACTCTACTAGG - Intergenic
1190222334 X:48520513-48520535 CCTCTCAGGGTGCCACTGATGGG + Exonic
1190412975 X:50155438-50155460 CATCACAGGGTGATTTTATTGGG + Intergenic
1190982253 X:55466626-55466648 CCTCACAAGGTGACCTTATTTGG + Intergenic
1190986446 X:55506557-55506579 CCTCACAAGGTGACCTTATTTGG - Intergenic
1191716707 X:64198679-64198701 CCTCACTGGTTGCCACTGTTTGG + Intronic
1193543584 X:82800382-82800404 CCTCAGAGTGTGACTATATTTGG + Intergenic
1194335123 X:92636628-92636650 CCTCAGAATGTGACTGTGTTTGG - Intergenic
1194974690 X:100382139-100382161 ACTTACAGTGAGACTCTGTTTGG + Intronic
1198464932 X:136896581-136896603 CCTCAGAATGTGACTCTATTTGG - Intergenic
1198640922 X:138755870-138755892 CCTCACAATGTGACTATATTTGG + Intronic
1198659122 X:138947785-138947807 CCTCGGAGGGTGACTGTATTTGG + Intronic
1199517181 X:148691047-148691069 CCTCAGATTGTGACTATGTTTGG - Intronic
1199720307 X:150538748-150538770 CCTCAGAGGGTGACGTTATTTGG + Intergenic
1200643593 Y:5753680-5753702 CCTCAGAATGTGACTGTGTTTGG - Intergenic
1201284082 Y:12364188-12364210 CCTCAGACTGTGACTCTATTTGG + Intergenic
1201673819 Y:16557009-16557031 CCTCCCAAGGTGACGGTGTTAGG + Intergenic