ID: 907268061

View in Genome Browser
Species Human (GRCh38)
Location 1:53274810-53274832
Sequence ACAGGGTGACTCTGTTGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 634
Summary {0: 1, 1: 0, 2: 1, 3: 62, 4: 570}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907268051_907268061 9 Left 907268051 1:53274778-53274800 CCACTCTTACACTGAAATCTGCG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 907268061 1:53274810-53274832 ACAGGGTGACTCTGTTGGGCCGG 0: 1
1: 0
2: 1
3: 62
4: 570
907268047_907268061 28 Left 907268047 1:53274759-53274781 CCCGCCGTCCACGCGCTTGCCAC 0: 1
1: 0
2: 1
3: 0
4: 53
Right 907268061 1:53274810-53274832 ACAGGGTGACTCTGTTGGGCCGG 0: 1
1: 0
2: 1
3: 62
4: 570
907268049_907268061 24 Left 907268049 1:53274763-53274785 CCGTCCACGCGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 907268061 1:53274810-53274832 ACAGGGTGACTCTGTTGGGCCGG 0: 1
1: 0
2: 1
3: 62
4: 570
907268048_907268061 27 Left 907268048 1:53274760-53274782 CCGCCGTCCACGCGCTTGCCACT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 907268061 1:53274810-53274832 ACAGGGTGACTCTGTTGGGCCGG 0: 1
1: 0
2: 1
3: 62
4: 570
907268050_907268061 20 Left 907268050 1:53274767-53274789 CCACGCGCTTGCCACTCTTACAC 0: 1
1: 0
2: 0
3: 0
4: 33
Right 907268061 1:53274810-53274832 ACAGGGTGACTCTGTTGGGCCGG 0: 1
1: 0
2: 1
3: 62
4: 570

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907268061 Original CRISPR ACAGGGTGACTCTGTTGGGC CGG Intronic
900076246 1:820263-820285 ACAGGGTGGTTCTGCTGGACAGG - Intergenic
900076252 1:820298-820320 ACAGGGTGGATCTGCTGGACAGG - Intergenic
900076292 1:820508-820530 ACAGGGCGGATCTGCTGGGCTGG - Intergenic
900076305 1:820578-820600 ACAGGGTGGATCTGCTGGCCAGG - Intergenic
900076326 1:820718-820740 ACAGGGTGGATCTTTTGGACAGG - Intergenic
900076336 1:820788-820810 ACAGGGTGGATCTGCTGGGGAGG - Intergenic
900076355 1:820893-820915 ACAGGGTGGATCTGCTGGCCAGG - Intergenic
900076403 1:821208-821230 ACAGGGTGGATCTGCTGGACAGG - Intergenic
900076420 1:821348-821370 ACAGGGTGGATCTGCTGGGCAGG - Intergenic
900076432 1:821418-821440 ACAGGGTGGCTCTGCTGGACAGG - Intergenic
900076461 1:821593-821615 ACTGGGTGAATCTGCTGGCCAGG - Intergenic
900076518 1:821974-821996 ACAGGGTGGATCTGCTGGGCAGG - Intergenic
900076596 1:822428-822450 ACAGGGTGGATCTGCTGGCCAGG - Intergenic
900076603 1:822463-822485 ACAGGGTGGATCTGCTGGCCAGG - Intergenic
900076630 1:822638-822660 ACAGGGTGGATCTGCTGGACAGG - Intergenic
900076641 1:822708-822730 ACAGGGTGGATCTGCTGAGCAGG - Intergenic
900076663 1:822848-822870 ACAGGGCGGATCTGCTGGGCAGG - Intergenic
900076671 1:822883-822905 ACAGGGTGGATCTGCTGGCCAGG - Intergenic
900076677 1:822918-822940 ACAGGGTGGATCTGCTGGGCAGG - Intergenic
900076704 1:823093-823115 ACAGGGTGGATCTGCTGGACAGG - Intergenic
900076719 1:823198-823220 ACAGGGTGGATCTGCTGGGCAGG - Intergenic
900076750 1:823373-823395 ACAGGGTGGATCTGTTGGGTAGG - Intergenic
900076774 1:823513-823535 ACAGGGTGGATCTGCTGGGCAGG - Intergenic
900076793 1:823618-823640 ACAGGGTGGATCTGCTGGACAGG - Intergenic
900202194 1:1413804-1413826 TCAGGGTGGTTCTTTTGGGCTGG + Intergenic
901074330 1:6543524-6543546 ACAGTGTCACTCTGTTGCCCAGG + Intronic
902779350 1:18694268-18694290 ACAGGGTTTCTATGTTGGTCAGG - Intronic
902889825 1:19434531-19434553 AAAGGCTTACTCTGTTGGTCAGG - Intronic
903279645 1:22243401-22243423 ACAGGGTCTCTCTGTTGCCCAGG - Intergenic
903310364 1:22450938-22450960 ACAGGGTGACTGTGTTCAGTGGG + Intergenic
903590650 1:24453333-24453355 ACCGGGAGACCCTGGTGGGCTGG - Intronic
903608686 1:24593915-24593937 ACAGAGTGACTCTGTCGCCCAGG + Intronic
903799550 1:25956423-25956445 ACAGTGTCACTCTGTTGCCCAGG - Intergenic
903831663 1:26178815-26178837 GCACGGTGACTGTATTGGGCTGG - Intronic
904170452 1:28588627-28588649 TCAGGGTGGTTCTTTTGGGCTGG + Intergenic
904502918 1:30927178-30927200 ACAGGGTTTCTATGTTGGCCAGG - Intergenic
904776320 1:32909550-32909572 ACAGGGTTGCTCTGTTGCCCAGG + Intergenic
905569807 1:38994529-38994551 ACAGAGTCACTCTGTTGCCCAGG + Intronic
905755298 1:40504335-40504357 ACAGAGTCACTCTGTTGCCCAGG + Intergenic
906061617 1:42952802-42952824 AGAGGTGGACTCTCTTGGGCTGG - Intronic
906268077 1:44450018-44450040 ACAGGGTCTCTCTGTTGGTCAGG - Intronic
907131564 1:52101877-52101899 ACAGGCTCACTCTGTTGCCCAGG - Intergenic
907215378 1:52859090-52859112 ACAGAGTCACTCTGTTGTTCAGG + Intronic
907268061 1:53274810-53274832 ACAGGGTGACTCTGTTGGGCCGG + Intronic
907273203 1:53302716-53302738 ACAGGGTTTCCCTGTTGGCCAGG + Intronic
907367824 1:53977141-53977163 ACAGGGTCTCTCTGTTGCCCAGG - Intergenic
908036446 1:60059502-60059524 GGAGGGTGACTCTAATGGGCTGG - Intronic
908182480 1:61619573-61619595 ACAGGCTCACTCTGTTGCCCAGG - Intergenic
908839974 1:68269790-68269812 ACAGGGTGACTCACCTGGGCTGG + Intergenic
909164560 1:72202754-72202776 ACAGGGTGACTCTGTTAGCTTGG + Intronic
909633748 1:77793127-77793149 ACAGGGTCTCTCTGTTGCCCGGG + Intronic
910852657 1:91663994-91664016 TCAGGGTGATTCTTTTGAGCCGG + Intergenic
910994064 1:93085510-93085532 ACAGGGTCTCTCTGTTGCCCAGG + Intronic
912510838 1:110189278-110189300 ACAGGTTGATGGTGTTGGGCAGG - Intronic
913364427 1:118020407-118020429 ACAGTGTCACTCTGTTGCCCAGG - Intronic
914344585 1:146787758-146787780 ACAGGGTAGCCCTGCTGGGCAGG - Intergenic
914733459 1:150393429-150393451 ACAGGGTCTCTCTGTTGCCCAGG - Intronic
914741353 1:150467965-150467987 ACAGGTTTACCCTGTTGGCCAGG - Intronic
915379151 1:155425157-155425179 ACAGGGTCACCATGTTGGTCAGG + Intronic
915383806 1:155470431-155470453 ACAGACTCACTCTGTTGGCCAGG - Intronic
915389737 1:155530957-155530979 AGAGTGTCACTCTGTTGGCCAGG - Intronic
916057982 1:161081138-161081160 ACAGGGTGTGTGTGTTGAGCAGG + Intronic
916766754 1:167868309-167868331 TCAGGGTGATTCTTTTGGGCCGG - Intronic
916901489 1:169228868-169228890 ACAAGGTGACTCTGTTGCAAAGG - Intronic
917116098 1:171605230-171605252 TCAGGGTGATTCTTTTGGGCCGG - Intergenic
918119578 1:181526460-181526482 AAAGGGTGTATCTGTTGGTCTGG + Intronic
918397339 1:184127729-184127751 ACAGGGTCACTCTGTTGCCCAGG + Intergenic
918877329 1:190064882-190064904 ACAGGCTGACTCTCTTGGTAGGG - Intergenic
919308404 1:195874383-195874405 ACAGGGTGACTCTCTTGTTAGGG - Intergenic
919802850 1:201364073-201364095 ACAGGGTTTCTCCGTTGGTCAGG + Intronic
920450467 1:206057320-206057342 TCAGGGTGGTTCTTTTGGGCTGG - Intronic
920902088 1:210120387-210120409 ATAGGGTCACTCTGTTAGGCTGG + Intronic
920921818 1:210303702-210303724 TCAAGGTGACTCTGTGGGCCAGG - Intergenic
921074944 1:211693023-211693045 TCAGGGTGATTCTTTTGAGCCGG - Intergenic
921169774 1:212536294-212536316 ACAGAGTAATTCTGTTTGGCTGG - Intergenic
922296116 1:224251246-224251268 ACAGTATCACTCTGTTGGCCAGG - Intronic
922312785 1:224411722-224411744 ACAGGGTCTCTCTGTTGCCCAGG + Intronic
922680459 1:227590934-227590956 TCAGGGTGATTCTTTTGGGCCGG + Intronic
922727890 1:227933010-227933032 ACAGGGTGACTCTCTTGATAGGG - Intronic
922823341 1:228500029-228500051 ACAGGGTGACTCTCTTGTTAGGG - Intergenic
923623908 1:235598749-235598771 ACAGGCTCACTCTGTTGCCCAGG + Intronic
923763230 1:236867180-236867202 ACAGGCTGACTCTCTTGTGGAGG + Intronic
923883973 1:238134967-238134989 TCAGGTTGACTCTGTTTTGCAGG + Intergenic
924814686 1:247431399-247431421 ACAAGGTGAGTGTGTTGAGCCGG - Intronic
924858753 1:247899863-247899885 TCAGGGTGATTCTTTTGAGCCGG + Intergenic
924928573 1:248706914-248706936 ACAGGGTGTCTATGTTGCCCAGG - Intergenic
1063448505 10:6135393-6135415 ACAGTCTCACTCTGTTGCGCAGG + Intergenic
1063535603 10:6879473-6879495 ACAGAGTCACTCTGTTGCCCAGG - Intergenic
1064095781 10:12423622-12423644 ACAGGGAACCTCTGTTGGTCTGG + Intronic
1064670203 10:17706040-17706062 ACAGGGTGTCGCTGTTGCCCAGG - Intronic
1065001252 10:21339574-21339596 ACAGGGTCTCTCTGTTGCCCAGG + Intergenic
1065802126 10:29362010-29362032 TCAGGGTGATTCTTTTGGGCTGG + Intergenic
1066682458 10:37947315-37947337 ACAGGGTTTCACTGTTGGCCAGG + Intergenic
1067263905 10:44720436-44720458 ACAGAGTGACTCTGTTGCCCAGG + Intergenic
1067287965 10:44921278-44921300 ATAAGGTACCTCTGTTGGGCTGG + Intronic
1068248107 10:54399699-54399721 TCATGGTGATTCTCTTGGGCTGG - Intronic
1068671495 10:59728004-59728026 ACAGGGTGAGTCTTTTGAGCCGG + Intronic
1068675503 10:59765491-59765513 TCAGGGTGATTCTTTTGGGCTGG + Intergenic
1069319977 10:67157801-67157823 TCAGGGTGATTTTTTTGGGCTGG - Intronic
1071170201 10:82855421-82855443 ACAGTGTCACTCTGTTGCCCAGG + Intronic
1071828072 10:89345139-89345161 ACAGAGTTACTCTGTTGCCCAGG - Intronic
1072130135 10:92485914-92485936 ACAGGGTCTCTCTGTTGCCCAGG - Intronic
1073203074 10:101751946-101751968 ACGGGGTTACTCTGTTGCCCAGG - Intergenic
1073455803 10:103636032-103636054 ACAGGTGGACTCTGCTGGGCCGG - Intronic
1073988247 10:109233914-109233936 ACTGACTGACTCTATTGGGCTGG - Intergenic
1074455906 10:113594906-113594928 ACAGGCTGAGTGTGTTGGCCTGG - Intronic
1075071323 10:119321726-119321748 GCAGGGGGACTGTGGTGGGCAGG - Intronic
1075400317 10:122156517-122156539 AAAGAGTGACCCTGTTGGCCAGG - Intronic
1075422144 10:122309663-122309685 ACAGGGCCACTCTGTTGCCCAGG + Intronic
1075723902 10:124602094-124602116 TCTGGGTGTCTCTGGTGGGCTGG - Intronic
1075798508 10:125137350-125137372 CCCTGGTGACTCTGGTGGGCTGG + Intronic
1076012898 10:127004723-127004745 ACAGGATGACTCTGTAGCCCAGG - Intronic
1076534201 10:131166557-131166579 CCTGGGGGACTCTGTTGGGAAGG - Intronic
1076674619 10:132141630-132141652 ACAGGGTGAGCCTGCTGGGCTGG - Intronic
1076764313 10:132624827-132624849 GGAGGGTGACACTGTGGGGCAGG - Intronic
1077072823 11:684853-684875 ACAGGATGACTTGGTGGGGCTGG - Intronic
1077528741 11:3084989-3085011 ACAGAGTCACTCTGTTGCCCAGG - Intergenic
1078052452 11:7978627-7978649 ACAGGGTAACCCTGTTGCCCAGG + Intronic
1078342650 11:10510129-10510151 AGAGGGTGACTCACTGGGGCGGG + Intergenic
1078951071 11:16134942-16134964 ACAGGCTGACTCTCTTGGGAGGG + Intronic
1079194834 11:18316267-18316289 ACAGGTTGTCTCTGTTGCTCAGG - Intronic
1080218330 11:29871234-29871256 ACAGGGTCTCTCTGTTGCCCAGG + Intergenic
1080605368 11:33860830-33860852 CCAGGGTGTCTCAGTTGGGTAGG - Intronic
1081240625 11:40701761-40701783 ATAGGGTGACTCTATTATGCAGG - Intronic
1081889792 11:46531371-46531393 ACAGAGTGACCTTCTTGGGCAGG + Intronic
1081893951 11:46568579-46568601 ATGGGGTGTCTCTGTTGGTCAGG - Intronic
1082808510 11:57464531-57464553 AGAGGGTGACTCTGATAGGAAGG + Intronic
1083081924 11:60102922-60102944 TCAGGGTGATTCTTTTGAGCCGG + Intergenic
1083355211 11:62061125-62061147 ACAGGGTCTCTCTGTTGCTCAGG + Intergenic
1083575168 11:63785397-63785419 ACAGGGTCTCTCTGTTGCCCAGG - Intergenic
1083590427 11:63890475-63890497 ACAGGGTGGCTGTGAAGGGCTGG - Intronic
1083658795 11:64242554-64242576 ACACGGTGAGTGGGTTGGGCGGG + Exonic
1084121166 11:67069880-67069902 ACAGGGTTTCACTGTTGGCCAGG + Intronic
1085807553 11:79650124-79650146 ACAGAGTGACACAGTTGGCCAGG + Intergenic
1086143388 11:83523880-83523902 ACTGGCTGACTCTAATGGGCAGG - Intronic
1086973150 11:93105070-93105092 TCAGGGTGATTCTTTTGAGCTGG + Intergenic
1087594109 11:100232126-100232148 ACAGTCTCACTCTGTTGGCCAGG - Intronic
1088460935 11:110082059-110082081 ACAGGGAGATACTGTTGGTCTGG + Intergenic
1088931157 11:114351922-114351944 ACAAGGAGCCTCTGGTGGGCCGG + Intergenic
1089494291 11:118900601-118900623 ACAGGGTGAGTCAATTGCGCAGG - Exonic
1090999208 11:131894323-131894345 CCAGGGTGAATCTGTTGGTGGGG - Intronic
1091114442 11:133000080-133000102 ACAGTCTCACTCTGTTGGCCAGG + Intronic
1091496029 12:973501-973523 ACAGTCTGGCTCTGTTGCGCAGG + Intronic
1091557106 12:1582098-1582120 ACAGAGTCACTCTGTTGCTCAGG - Intronic
1092221213 12:6715270-6715292 ACAGGGTTTCACTGTTGGCCAGG + Intergenic
1092570345 12:9714685-9714707 TCAGGGTGGTTCTTTTGGGCTGG + Intergenic
1093032912 12:14305248-14305270 AGAGGCTCACTCTGTTGCGCTGG - Intergenic
1093575224 12:20719991-20720013 ACAGGGTGACTCTCTTGTTAGGG + Intronic
1093818319 12:23578092-23578114 ACAGTCTCACTCTGTTGCGCAGG - Intronic
1094703048 12:32888814-32888836 ACAGGGTCACTCTGTTGCCCAGG + Intronic
1094704721 12:32903477-32903499 AAAGGGTGTCTGTGTGGGGCAGG - Intergenic
1095745884 12:45658271-45658293 ACAGTGCCACTCTGTTGGTCAGG + Intergenic
1096205200 12:49715717-49715739 ACAGAGTCACTCTGTGGTGCAGG + Intronic
1097105980 12:56625179-56625201 ACAGTGTGGCTCTGTTGCCCAGG + Intronic
1098248701 12:68546407-68546429 TCAGGGTGATTCTTTTGAGCTGG - Intergenic
1098341023 12:69451249-69451271 ACAGGGTCTCTCTGTTGCTCAGG - Intergenic
1098748954 12:74271488-74271510 TCAGGGTGATTCTTTTGAGCTGG - Intergenic
1099656054 12:85493632-85493654 ACAGAGTGGCTCTGTTGCTCAGG + Intergenic
1100261595 12:92937247-92937269 ACAGGGTTTCTATGTTGGCCAGG - Intergenic
1100499312 12:95158191-95158213 ACAGGGTCTCACTGTTGGTCAGG + Intronic
1100507745 12:95236594-95236616 AGAGGGAGTCTCTGTTGCGCAGG + Intronic
1100567705 12:95813924-95813946 ACAGTCTGACTCTGTTGCCCAGG + Intronic
1101774369 12:107780105-107780127 ACAGTGTCACTCTGTTGCCCAGG - Intergenic
1102932171 12:116870772-116870794 ACAGGGTCTCTCTGTTGCCCAGG - Intronic
1103639583 12:122338689-122338711 ACAGTCTCACTCTGTTGCGCAGG - Intronic
1103974592 12:124694172-124694194 ACAGAGTCACTCTGTTGCCCAGG - Intergenic
1103991712 12:124803857-124803879 ACAGGGTTTCTCTGTTGCCCAGG - Intronic
1104556106 12:129801062-129801084 TCAGGGAGACTCTGTGGGCCAGG - Intronic
1107727948 13:43318947-43318969 CCAGGTTGACTCTGTGGGGCGGG - Intronic
1107854286 13:44599541-44599563 ACAGCCTCACTCTGTTGTGCAGG + Intergenic
1108780265 13:53821850-53821872 CCAGGCGGACTCCGTTGGGCCGG + Intergenic
1109803299 13:67404350-67404372 TCAGGGTGATTCTTTTGAGCAGG - Intergenic
1110229157 13:73150727-73150749 ACGGGGTGTCACTGTTGGCCCGG - Intergenic
1110256293 13:73437352-73437374 ACAGGGTCTCACTGTTGTGCAGG + Intergenic
1112300924 13:98229520-98229542 ACAGGGTCTCTCTGTTGCCCAGG + Intronic
1112653375 13:101422293-101422315 ACAGGCTAACTCTGTTGTGAGGG - Intergenic
1114326896 14:21598635-21598657 ACAGGGTCTCTCTGTTGCCCAGG + Intergenic
1114798398 14:25742555-25742577 AAAGGGTGAGTGTGTTGGGGTGG + Intergenic
1115608271 14:35027324-35027346 AAAGTATGAGTCTGTTGGGCTGG - Intronic
1115812753 14:37128606-37128628 ACAGTCTGACTCTGTTGCCCAGG + Intronic
1115817318 14:37177241-37177263 ACAGGGTCTCTCTGTTGCCCAGG - Intergenic
1116182361 14:41551191-41551213 ACAGGGTTACTCTGTTACCCAGG - Intergenic
1116240752 14:42339289-42339311 TCAGGGTGATTCTTTTGAGCTGG + Intergenic
1116897856 14:50334752-50334774 AAAGGGAGACTGTTTTGGGCAGG - Exonic
1117447769 14:55821083-55821105 TCAGGATGATTCTTTTGGGCTGG + Intergenic
1118381600 14:65222101-65222123 ACAGGGTCACTATGTTGTCCAGG - Intergenic
1118481026 14:66166041-66166063 ACATGGTGATACAGTTGGGCTGG + Intergenic
1118534944 14:66751797-66751819 ACAGGTTGACTCTCTTGGTAGGG - Intronic
1118653305 14:67921231-67921253 ACAGGGTATCTCTGTTGTCCAGG + Intronic
1118797541 14:69156859-69156881 ACAGGGTCTCTCTGTTGCCCAGG + Intergenic
1119304492 14:73596622-73596644 ACAGAGTCACTCTGTTGCCCAGG + Intergenic
1121212696 14:92220883-92220905 AAAGCGAGACTCTGTTGGCCAGG + Intergenic
1121544032 14:94750665-94750687 GCAGGGTGAATCTGAGGGGCTGG - Intergenic
1122000742 14:98650010-98650032 ACAGTGTCACTCTGTTGCCCAGG + Intergenic
1122046890 14:99030191-99030213 TCAGTGTGACTTTCTTGGGCTGG - Intergenic
1122809588 14:104281432-104281454 AGAGGGTGGCTCTGCTGGGTGGG - Intergenic
1122882317 14:104695645-104695667 GGAGGGTGACTCTGTAGGGGGGG - Intronic
1123108500 14:105854426-105854448 TCTCGGTGACCCTGTTGGGCAGG + Intergenic
1123830072 15:24127085-24127107 ACAGAGTCACTCTGTTGCCCAGG + Intergenic
1123860130 15:24457700-24457722 ACAGAGTCACTCTGTTGCCCAGG + Intergenic
1123968943 15:25486449-25486471 ACAGGGTGTGTGTGCTGGGCTGG + Intergenic
1125298675 15:38231113-38231135 ACAGGGTTTCTATGTTGGCCAGG + Intergenic
1125638115 15:41206448-41206470 ACAGGGTCTCTCTGTTGCCCAGG - Intronic
1125686311 15:41565432-41565454 ACAGGGTCTCACTGTTGGCCAGG + Intronic
1125708776 15:41766593-41766615 AAATGATGACTCTGTTGGCCTGG + Exonic
1126123546 15:45274768-45274790 ACAGGCTCACTCTGTTGCCCCGG + Intronic
1127095965 15:55512567-55512589 TCAAGGTGACTCTTTTGAGCTGG + Intergenic
1127140740 15:55973511-55973533 ACAGGGCTACTCTGTTGACCAGG - Intronic
1127422635 15:58822226-58822248 ACAGAGTCACTCTGTTGCCCAGG - Intronic
1128106726 15:65050868-65050890 GCAGGGTCACTCTGTTGCCCAGG + Intronic
1128108537 15:65061751-65061773 AAATGGTGCCTATGTTGGGCCGG + Intronic
1128263003 15:66245604-66245626 ACAGGGTCACACTGTTGCCCAGG - Intronic
1128324361 15:66714213-66714235 ACATGGTCACTCTGCAGGGCTGG - Intronic
1131273818 15:90963798-90963820 ACAGGGTCTCTCTGTTGTCCAGG + Intergenic
1131710622 15:95051858-95051880 ACAGGTTGACTCTGGTGGGTTGG - Intergenic
1132045653 15:98560968-98560990 ACAGGGTCTCTCTGTTGCCCAGG + Intergenic
1132597698 16:760836-760858 CCAGGGTAACTCTGATGTGCAGG - Intronic
1133012755 16:2924008-2924030 ACAGGGTCTCTCTGTTGCCCAGG - Intronic
1134651329 16:15911215-15911237 ACAGGTTGGCTCTGTTGCCCAGG - Intergenic
1134763452 16:16734573-16734595 ACAGGGTCACTCTGTTGCCCAGG + Intergenic
1134982600 16:18624584-18624606 ACAGGGTCACTCTGTTGCCCAGG - Intergenic
1135256672 16:20946848-20946870 ACAGGGTCACTCTGTGGCCCAGG + Intronic
1137728515 16:50673109-50673131 ACAGGGTCTCTCTGTTGCCCAGG - Exonic
1138000428 16:53273061-53273083 ACAGAGTCACTCTGTTGCTCAGG - Intronic
1138624392 16:58237514-58237536 ACAGGATCACTCTGTTGCCCAGG + Intronic
1138890843 16:61142492-61142514 ACAGGGAGAATCTGTTGGCATGG - Intergenic
1139459681 16:67111644-67111666 ACAGAGTCACTCTGTTGCCCAGG + Intronic
1139555010 16:67702446-67702468 ACAGAGTCACTCTGTTGCCCAGG - Intronic
1139989407 16:70927548-70927570 ACAGGGTAGCCCTGCTGGGCAGG + Intronic
1140225799 16:73075821-73075843 ACAGGGTTTCACTGTTGGCCAGG + Intergenic
1140281465 16:73558736-73558758 ACAGTCTCACTCTGTTGTGCAGG + Intergenic
1141128317 16:81417014-81417036 ACCTGCTGACACTGTTGGGCGGG + Intergenic
1142499436 17:324017-324039 ACAGGGCGACTCTGAGGGTCTGG - Intronic
1142660649 17:1426834-1426856 ACAGTGTAACTCTGTTGGCCAGG - Intronic
1142833096 17:2563960-2563982 ACAGAGTCACTCTGTTGCCCAGG + Intergenic
1145726691 17:27134140-27134162 TCATGGTGATTCTCTTGGGCTGG - Intergenic
1146591749 17:34133433-34133455 TCAGGCTGTCTCTGTTGAGCTGG + Intronic
1146764468 17:35506803-35506825 TCAGGGTGAGTCTTTTGAGCTGG - Intronic
1147275302 17:39311139-39311161 ACAGGCTTACTCTGTTGTCCAGG - Intronic
1147810003 17:43161738-43161760 TCAGGGTGATTCTTTTGAGCTGG + Intergenic
1150031543 17:61741884-61741906 ACAGGCTGACTCTCTTGTGATGG - Intronic
1150425317 17:65072846-65072868 CCAGGGTGATTCTGTTGGTTAGG + Intergenic
1150437844 17:65167893-65167915 GCAGTGTGACCCTGGTGGGCTGG + Intronic
1150605702 17:66688775-66688797 ACAGGGTAGCTCTGTTGTGCAGG - Intronic
1151867362 17:76812893-76812915 ATAGGGTCACTCTGTTGCCCAGG - Intergenic
1151946656 17:77323420-77323442 ACTGGGGAGCTCTGTTGGGCTGG + Intronic
1152455260 17:80411958-80411980 TCAGGGTGATTCTTTTGAGCCGG - Intergenic
1152649708 17:81487136-81487158 ACAGGGTCACTCTGTCGCCCAGG + Intergenic
1152981532 18:282373-282395 ACAGGCTGACTCTCTTGGTAGGG + Intergenic
1154209899 18:12370494-12370516 ACAGGGTCTCTCTGTTGCCCAGG + Intronic
1154227706 18:12522637-12522659 ACAGGGTGACTCTCTTGTTAGGG + Intronic
1155144832 18:23074847-23074869 ACAGGGTCTCTCTGTTGCCCAGG + Intergenic
1155167901 18:23246072-23246094 ACAGGGTTACACCGTTGGCCAGG - Intronic
1155299916 18:24419647-24419669 ACAGTCTGACTCTGTTGCCCAGG - Intergenic
1156000409 18:32378472-32378494 ACAGTCTGACTCTGTTGCCCAGG - Intronic
1156719493 18:40052595-40052617 ACAGAGTCACTCTGTTGCCCAGG + Intergenic
1157171164 18:45407033-45407055 ACAGGGTGACTCTCTTGTTAGGG - Intronic
1157662273 18:49455921-49455943 ACAGTCTGACTCTGTTGCTCAGG - Intronic
1159043188 18:63344599-63344621 ATGGGGTGATTCTGTTAGGCGGG + Intronic
1159226032 18:65537003-65537025 ACAGAGTCACTCTGTTGCCCAGG - Intergenic
1160218049 18:76951208-76951230 ACAGGCTGACTCTCTTGTGAGGG - Intronic
1160320514 18:77889022-77889044 ACAGGCTGACTCTCTTGTGAGGG - Intergenic
1160592946 18:79954031-79954053 ACAGGGTCTCTGTGTTGGCCAGG + Intergenic
1161485610 19:4534085-4534107 ACAGGGTCACCCTGCGGGGCAGG + Exonic
1161644169 19:5443076-5443098 ACAGGGTCACTCTGTTGCCCAGG + Intergenic
1161742246 19:6029051-6029073 ACAGTCTCACTCTGTTGGCCAGG - Intronic
1161830546 19:6600560-6600582 TCAGGGTGATTCTTTTGAGCTGG - Intronic
1162089006 19:8265978-8266000 ACAGGGTCTCTCTGTTGCGCAGG - Intronic
1162141344 19:8587180-8587202 ACAGGATGTCTCTGTTGCCCAGG + Intronic
1162325894 19:9999214-9999236 ACAGGGTCACTCTATTGCCCAGG + Intronic
1162407218 19:10482181-10482203 ACAGAGTGACTCTGTTGTCCAGG - Intergenic
1162409053 19:10493752-10493774 ACGGGGTGACTGTGTTAGCCAGG + Intronic
1162492391 19:11001078-11001100 ACAGGGTCTCTCTGTTGTCCAGG + Intronic
1162534596 19:11255328-11255350 ACAGGGTTGCTCTGTTGCCCAGG + Intronic
1162960211 19:14121144-14121166 ACAGTCTCACTCTGTTGGTCAGG + Intronic
1163119739 19:15210280-15210302 ATAAGGTCACTCTGTTGGCCAGG - Intergenic
1163269961 19:16247048-16247070 ACAGAGTCACTCTGTTGCCCAGG - Intergenic
1163316995 19:16547441-16547463 ACAGAGTCACTCTGTTGCCCAGG - Intronic
1163672958 19:18639265-18639287 ACAGGGTTTCACTGTTGGCCAGG + Intronic
1163847583 19:19646296-19646318 ACAGGTTGAAGATGTTGGGCAGG + Exonic
1163905285 19:20147015-20147037 ACAGTCTGACTCTGTTGCACAGG - Intergenic
1164061989 19:21683589-21683611 ACAGTCTCACTCTGTTGGCCAGG + Intergenic
1164444850 19:28308200-28308222 ACAGGGTGGGTCTGTGGGGCTGG - Intergenic
1165680729 19:37772657-37772679 ACAGGCTCACTCTGTTGCCCAGG + Intronic
1165716696 19:38050428-38050450 ACAGTCTCACTCTGTTGGCCAGG - Intronic
1165828540 19:38719260-38719282 CCAGGGAGACTGTGTTGGGAAGG - Intronic
1165922836 19:39309262-39309284 ACAGGGTTACCATGTTGGCCAGG - Intronic
1165945260 19:39437905-39437927 ACAGGGAGACACTGGAGGGCAGG + Intronic
1166013180 19:39959149-39959171 ACAGGATGTCTCTGTTGCCCAGG - Intergenic
1166782926 19:45351744-45351766 AGAGGGGGGCACTGTTGGGCAGG + Intronic
1167280023 19:48561674-48561696 ACAGTGGGACTCGGATGGGCAGG + Intronic
1167309788 19:48730353-48730375 ACAGGGTCACCATGTTGGCCAGG + Intronic
1167401478 19:49273986-49274008 ACAGGGTCTCTCTGTTGCCCAGG - Intergenic
1167538690 19:50071833-50071855 ACAGAGTCACTCTGTTGCCCAGG + Intergenic
1167617817 19:50545747-50545769 ACAGGGTCTCTCTGTTGCCCAGG + Intronic
1167935222 19:52900392-52900414 TCAGGGTGGTTCTTTTGGGCTGG + Intergenic
1168039617 19:53747635-53747657 ACAGGGTGTCTCTGTTGCCCAGG + Intergenic
1168626566 19:57922972-57922994 ACAGTGTCACTCTGTTGCCCAGG - Intronic
925153074 2:1629616-1629638 ACAGGGTGACTCTCTTGCCATGG + Intergenic
925556716 2:5139073-5139095 ACAGGGTGACTCTCTTGTTAGGG + Intergenic
925993771 2:9275259-9275281 ACAGGGTGTCACTGTTGGCCAGG + Intronic
926185321 2:10686034-10686056 ACAGGTTTACTCTGTTGCCCAGG - Intronic
929036208 2:37694442-37694464 ACAGGCTCACTCTGTTGCCCAGG - Intronic
931632878 2:64317070-64317092 ACAAGGTCACACTGTTGGGCTGG - Intergenic
932016015 2:68026987-68027009 ACAGAGTCACTCTGTTGCTCAGG - Intergenic
933105908 2:78324992-78325014 ACAGTGTCACTCTGTTGCCCAGG + Intergenic
933651007 2:84850362-84850384 ACAGGCGGACTCTGTGGGGGTGG - Intronic
933914591 2:86976353-86976375 ACGGGGTTTCTCTGTTGGCCAGG + Intronic
934008402 2:87793546-87793568 ACGGGGTTTCTCTGTTGGCCAGG - Intronic
934165504 2:89290447-89290469 ACAGAGGGACTCTGCAGGGCCGG + Intergenic
934852663 2:97711327-97711349 ACAGGGTGCCTCTGTGTGGGTGG - Intergenic
935446217 2:103159223-103159245 ACAAGGTGTCACTGTTAGGCAGG - Intergenic
935575845 2:104709611-104709633 TCAAGGTGACCGTGTTGGGCTGG - Intergenic
935970888 2:108529896-108529918 TCAGGGTGATTCTTTTGAGCTGG - Intergenic
935994427 2:108753625-108753647 ACGGGGTTTCTCTGTTGGTCGGG + Intronic
936129810 2:109826501-109826523 ACGGGGTTTCTCTGTTGGCCAGG + Intronic
936214887 2:110544984-110545006 ACGGGGTTTCTCTGTTGGCCAGG - Intronic
936419247 2:112347675-112347697 TCAGGGTGATTCTTTTGAGCTGG + Intergenic
936424024 2:112399547-112399569 ACGGGGTTTCTCTGTTGGCCAGG - Intronic
936771219 2:115915794-115915816 ACAGTCTCACTCTGTTGGCCAGG + Intergenic
937250326 2:120519644-120519666 AGAGGATGACTCTTTTGGGGCGG - Intergenic
938155891 2:128939677-128939699 ACAGGACCCCTCTGTTGGGCAGG + Intergenic
938627109 2:133122717-133122739 ACAGGGAGGCTCTGTGGGACTGG - Intronic
940002377 2:148979306-148979328 ACAGGGTCTCTCTGTTGTCCAGG + Intronic
941677209 2:168356394-168356416 ACAGGGTCACTCTGTTGCCTAGG - Intergenic
942110357 2:172675874-172675896 ACAGGCTGACTCTCTTGTGAAGG + Intergenic
942723614 2:178982812-178982834 TCAGGGAGACTCTGTGGGGTAGG - Intronic
944477205 2:200119128-200119150 TCAGGGTGGCTCTGTTTGGCTGG + Intergenic
944766018 2:202864970-202864992 GCAGGGTTTCTCTGTTGGCCAGG - Intronic
945771520 2:214048951-214048973 ACAGAGAGACCCTGTTGGGAAGG - Intronic
945771523 2:214048959-214048981 ACAGGGTCTCTCTGTTGCCCAGG + Intronic
946663077 2:222021412-222021434 AGAGTCTCACTCTGTTGGGCAGG - Intergenic
947315970 2:228858819-228858841 AGAGGGTGCCTCTGGAGGGCTGG - Intronic
947525322 2:230873804-230873826 CCAGGGTGACCCTGTGGGGCGGG - Intronic
947684543 2:232071328-232071350 ACAGGGTCACTATGTTGCCCAGG - Intronic
947770150 2:232664162-232664184 ACAGGGTTGCTCTGTTGCCCAGG + Intronic
948507320 2:238437769-238437791 CCAGGGTGGCTCTGATGAGCAGG + Intronic
948703043 2:239772676-239772698 ACTGGGTGGTTCTGGTGGGCAGG - Intronic
1168813376 20:720677-720699 AGAGGGTGACTCTGCAGGCCCGG - Intergenic
1168903920 20:1389307-1389329 ACAGGCTGTAACTGTTGGGCAGG - Intronic
1169012011 20:2258741-2258763 ACAGGGTCTCTCTGTTGCGCAGG + Intergenic
1169455589 20:5749745-5749767 ACAGGGTTTCTCTGTTGGTAAGG + Intergenic
1169610252 20:7371524-7371546 AGAGTGTGATTCTGTTGGTCTGG - Intergenic
1169797918 20:9485072-9485094 ACAGAGTGACTCTGTCGCCCAGG + Intergenic
1169820198 20:9701972-9701994 ACAGGGTCTCTCTGTTGTGCAGG - Intronic
1169942067 20:10947946-10947968 TCTGGGTGACTCTGTGAGGCAGG + Intergenic
1170237947 20:14128695-14128717 ACAGGGTGACACTCTTGGTAGGG + Intronic
1170400779 20:15980896-15980918 ACCGTATGACTCTGTTGAGCAGG + Intronic
1171502430 20:25604035-25604057 ACAGGGTGGCTGTGTCAGGCAGG + Intergenic
1173063061 20:39680578-39680600 CCAGGGAGTCTCTGTTGGTCAGG + Intergenic
1173201192 20:40956241-40956263 ACAGTGTCACTCTGTTGCCCAGG - Intergenic
1173223557 20:41148154-41148176 ACAGAGTAAATCTGTGGGGCTGG - Intronic
1173792910 20:45839881-45839903 ACAGGGTCTCACTGTTGGCCAGG - Intronic
1177795790 21:25777940-25777962 ACAGAGTCACTCTGTTGCCCAGG + Intergenic
1177815365 21:25970725-25970747 TCAGGGTGACACTGCTGGGAAGG - Intronic
1178448025 21:32663199-32663221 TCAGGGTGATTCTTTTGAGCTGG - Intronic
1178519108 21:33272470-33272492 ACAGTGTCACTCTGTTGCCCAGG + Intronic
1178838962 21:36123162-36123184 ACAGGCTCCCTCTGTTGGCCAGG - Intergenic
1179046655 21:37850659-37850681 ACAGGGTCAAGCTGCTGGGCCGG - Intronic
1179586698 21:42377990-42378012 TCAGAATGACTCTGGTGGGCTGG + Intronic
1181503480 22:23334128-23334150 ACAGTGTCACTCTGTTGCTCAGG + Intergenic
1181654041 22:24280601-24280623 ACAGTGTCACTCTGTTGCTCAGG + Intronic
1181708470 22:24664359-24664381 ACAGTGTCACTCTGTTGCTCAGG + Intergenic
1181835055 22:25598647-25598669 ACAGGGTCTCTCTGTTGCCCAGG - Intronic
1182242222 22:28925156-28925178 ACAAGCTGACTCCGTTTGGCAGG - Intronic
1182249828 22:28991254-28991276 AGAGGGTCTCTCTGTTGGCCAGG - Intronic
1182521765 22:30888701-30888723 ACAGGGTCTCTCTGTTGCCCAGG - Intronic
1183268062 22:36842483-36842505 ACAGGGTGACTCTATTGTTACGG + Intergenic
1183992773 22:41609600-41609622 ACTGGGTTTCTCTGTTGGCCAGG - Intronic
1184228673 22:43145724-43145746 ACAGTGTGACTATGTTGCCCAGG - Intergenic
949318104 3:2779290-2779312 ACAGGGTCACTCTGTCGCCCAGG + Intronic
949983645 3:9521248-9521270 ACAGTGTGGCTCTGTTGCCCAGG + Intronic
950519094 3:13485548-13485570 TCAGGGGAACTGTGTTGGGCAGG + Intronic
950606818 3:14089212-14089234 ACATGGTGATTCTCTTGTGCAGG - Intergenic
950703041 3:14763117-14763139 ACAGGGGGACGCTATTGGGAAGG + Intronic
950749158 3:15115220-15115242 ACTGGGTTGATCTGTTGGGCAGG - Intergenic
951248241 3:20365513-20365535 TCAGGGTGATTCTTTTGAGCTGG + Intergenic
951492805 3:23291706-23291728 ACAGGGTCACTCTGTTGCCCAGG + Intronic
952353046 3:32559264-32559286 ACAGGGCAACTCTGTTGCCCAGG + Intronic
952897201 3:38085541-38085563 ACAGCTTGGCTCTCTTGGGCAGG + Intronic
954338527 3:49935058-49935080 ACAGTCTCACTCTGTTGCGCAGG + Intergenic
954347787 3:50015021-50015043 ACAGTCTCACTCTGTTGGCCAGG - Intronic
954814224 3:53267894-53267916 ACAGGGTCTCTCTGTTGCCCAGG + Intergenic
954819138 3:53309737-53309759 ACAGGGTCTCTCTGTTGCCCAGG - Intronic
954824929 3:53364439-53364461 AGAGTGTCACTCTGTTGGCCAGG + Intergenic
955258199 3:57356763-57356785 ACAGTCTCACTCTGTTGCGCAGG + Intronic
955426640 3:58797742-58797764 ACAGGATGACTCTGTTGTTGGGG + Intronic
956295194 3:67704674-67704696 AGAGGGTGACTGAGGTGGGCAGG - Intergenic
956996282 3:74829789-74829811 TCAGGGTGGTTCTTTTGGGCTGG - Intergenic
957999602 3:87735115-87735137 TCAGGGTGATTCTTTTGGGCTGG + Intergenic
959067660 3:101674671-101674693 ACAGAGTCACTCTGTTGCCCAGG - Intronic
959097591 3:101972359-101972381 GTAGGGTGACTCTGCAGGGCTGG + Intergenic
960099629 3:113726832-113726854 ACAGGGTTGCTCTGTTGCCCAGG + Intronic
960648020 3:119911466-119911488 ACAGGTTGACTCTCTTGTGAGGG - Intronic
961048206 3:123724171-123724193 ACAGGTTCACTGTGTTGGCCAGG + Intronic
961447267 3:126986736-126986758 ACAGGGTGACTGAGCAGGGCGGG + Intergenic
962097689 3:132308866-132308888 TCAGGGTGATTCTTTTTGGCCGG - Intergenic
963037752 3:141047357-141047379 ACATGGTGACTCTGTAGGGCAGG - Intergenic
963642144 3:147874133-147874155 ACAGGGTCACTCTGTTGCCCAGG + Intergenic
964721900 3:159775593-159775615 ACAGGGTGCCTCTGGTGGCCAGG + Intronic
965830257 3:172778415-172778437 AAAGGGGGACTCAGTTTGGCAGG - Intronic
966700694 3:182847074-182847096 ACATGGTTACTCTGTTGCCCAGG + Intronic
966839675 3:184078327-184078349 ACAGTCTCACTCTGTTGGCCAGG + Intergenic
968677090 4:1888921-1888943 ACAGTCTCACTCTGTTGGCCAGG + Intronic
968781756 4:2587666-2587688 ACAGGGTCACTCTGTTGCCTAGG - Intronic
968802376 4:2751745-2751767 ACAGGGTCACTCTGTTGCCCAGG - Intronic
971132504 4:23828287-23828309 ACAGAGTGACGCTGATGGGACGG + Intronic
971478828 4:27096312-27096334 ACAGTGTGTCTGTGGTGGGCTGG + Intergenic
972077765 4:35107656-35107678 TCAGGGTGGTTCTTTTGGGCTGG - Intergenic
972275217 4:37550869-37550891 TCAGGGTGGTTCTTTTGGGCCGG - Intronic
972282687 4:37618427-37618449 ACAGGGTCACTATGTTGCCCAGG + Intronic
972406964 4:38756121-38756143 ACAGTCTCACTCTGTTGGGCAGG + Intergenic
972469621 4:39391390-39391412 ACAGTCTGACTCTGTTGCCCAGG + Intergenic
973553305 4:52056759-52056781 ACAGGGTGAGTCTGGTGGGGAGG - Intronic
974004870 4:56545693-56545715 ACAGGGTCTCTCTGTTGCCCAGG - Intronic
974949572 4:68571637-68571659 TCAGGGTGATTCTTTTGGGCTGG + Intronic
974988226 4:69055749-69055771 TCAGGGTGATTCTTTTGGTCTGG - Intronic
975347075 4:73304388-73304410 ACAGAGTCACTCTGTTGCCCAGG + Intergenic
976969722 4:91090578-91090600 TCAGGGTGGTTCTTTTGGGCTGG + Intronic
976990046 4:91354681-91354703 TCAGGGTGGTTCTTTTGGGCTGG + Intronic
977730657 4:100347360-100347382 ACAGAGTCACTCTGTTGCCCTGG + Intergenic
978123423 4:105108853-105108875 ACAGGGTCACACTGTTGCCCAGG - Intergenic
978710987 4:111780741-111780763 ACAGGGTCACCATGTTGGTCAGG - Intergenic
978754080 4:112284783-112284805 TCAGGGTGATCCTGTTGAGCAGG - Intronic
978938366 4:114406942-114406964 ACAGTGTCACTCTGTTGCCCAGG - Intergenic
979052745 4:115954932-115954954 TCAGGGTGATTCTTTTGGGCCGG - Intergenic
979264991 4:118690652-118690674 ACAGAGTCACTCTGTTGCCCAGG - Intronic
979648687 4:123105098-123105120 ATAGGGTGACTCTGTTGTTAGGG + Intronic
980122381 4:128741314-128741336 ACGGGGTTTCTCTGTTGGCCAGG - Intergenic
981320678 4:143387881-143387903 ACAAGGTGTTTCTGTTGGGCTGG - Intronic
982432174 4:155335825-155335847 ACAGGGTCTCTCTGTTGCCCAGG + Intergenic
983796261 4:171868010-171868032 ACAGTGTCACTCTGTTGCCCAGG + Intronic
986111722 5:4725628-4725650 AGAGGTTCACTCTGTGGGGCTGG - Intergenic
987320302 5:16762770-16762792 ACAGGGTTTCACTGTTGGCCAGG - Intronic
988083590 5:26444482-26444504 ACAGAGTCACTCTGTTGCCCAGG - Intergenic
988549001 5:32183664-32183686 ACAGAGTCACTCTGTTGCCCAGG + Intergenic
988820654 5:34881787-34881809 ACAGAGTCACTCTGTTGCCCAGG + Intronic
989232467 5:39101960-39101982 ACAGTCTCACTCTGTTGGCCAGG - Intergenic
989557876 5:42818217-42818239 TCAGGGTGGTTCTTTTGGGCTGG - Intronic
991066979 5:62434325-62434347 ACAGGGTTTCTCTGTTGCCCAGG + Intronic
991495762 5:67224175-67224197 ACAGAGTCACTCTGTTGCCCAGG - Intergenic
991514964 5:67425102-67425124 ACAGAGTCACTCTGTTGACCAGG - Intergenic
992765600 5:79996109-79996131 ACAGAGTCACTCTGTTGCCCAGG - Intronic
992810413 5:80382202-80382224 ACAGGGTGACTCTGAAAGGGTGG - Intergenic
992989406 5:82268838-82268860 TCAGGGTGATTCTTTTGGGCTGG + Intronic
995254696 5:110033129-110033151 ACAGTCTGACTCTGTTGCCCAGG + Intergenic
996699846 5:126439350-126439372 ACAGAGTCACTCTGTTGCCCAGG + Intronic
996705797 5:126497267-126497289 ACAGTCTCACTCTGTTGCGCAGG + Intergenic
997361446 5:133297823-133297845 CCAGGGTGTTTCTGATGGGCTGG + Intronic
998060440 5:139114793-139114815 ACAGCCTGATTCTGTTGGGGTGG - Intronic
998114988 5:139529979-139530001 TCAGGGTGGTTCTTTTGGGCTGG - Intronic
998456603 5:142278625-142278647 ACAGTGTCACTCTGTTGCCCAGG - Intergenic
998794950 5:145808856-145808878 ACAGGGTCCCTCTGTTGCCCAGG - Intronic
999142952 5:149374705-149374727 ACAGCAAGACTGTGTTGGGCTGG + Intronic
999166411 5:149552803-149552825 ACAGGGTCTCTCTGTTGCCCAGG - Intronic
999310714 5:150550124-150550146 ACAGGGTCACTCTGTTGCCCAGG + Intronic
999568540 5:152892776-152892798 ACAGTGTCACTCTGTTGCCCAGG + Intergenic
999654038 5:153795292-153795314 ACTGTGTGAGTGTGTTGGGCGGG + Intronic
1000068470 5:157717766-157717788 ACAGTGTTGCTCTGTTGGCCAGG + Intergenic
1000310896 5:160043564-160043586 ACAGGGTCACTCTGTTACCCAGG - Intronic
1000321826 5:160140400-160140422 ACAGAGTCACTCTGTTGCCCAGG - Intergenic
1000604598 5:163314610-163314632 TCAGGGTGGTTCTTTTGGGCTGG + Intergenic
1001613858 5:173026020-173026042 ACAGGGTCTCACTGTTGGTCAGG + Intronic
1002813156 6:653850-653872 ACAGGTTGACTCTGTTGTTAGGG + Intronic
1003315832 6:5011186-5011208 AGAGTCTGACTCTGTTGGCCAGG + Intergenic
1003611184 6:7616386-7616408 ACAGAGTCACTCTGTTGCCCAGG + Intergenic
1004229964 6:13823219-13823241 ACAGAGTGACTCTGTTGCCCAGG - Intergenic
1004379258 6:15118078-15118100 ACAGGGTCTCTCTGTTGCCCAGG - Intergenic
1004659670 6:17698845-17698867 ACAGTGTCACTCTGTTGCCCAGG - Intronic
1005041977 6:21608171-21608193 ACGGGGTTTCTCTGTTGGTCAGG - Intergenic
1005076572 6:21913877-21913899 ACAGAGTCACTCTGTTGCCCAGG - Intergenic
1005462237 6:26080179-26080201 TCAGGGTGAGTCTTTTGAGCTGG - Intergenic
1005633582 6:27732408-27732430 ACAGTGTCACTCTGTTGCCCAGG + Intergenic
1005663918 6:28029823-28029845 ACAGGGTGACTCTCTTGTTGGGG + Intergenic
1006126708 6:31843490-31843512 ACAGGGTGTCACTGTTGCCCAGG + Intergenic
1006570836 6:35002714-35002736 TCAGGGTGATTCTTTAGGGCCGG - Intronic
1006651985 6:35559082-35559104 ACAGAGTCACTCTGTTGCCCAGG - Intergenic
1006718670 6:36136204-36136226 ACACAGTGACTCTTTTGAGCAGG - Intronic
1007872235 6:45053601-45053623 AAAGGGTCACTCTGATGGCCGGG + Intronic
1011602061 6:89069207-89069229 ACAGAGTCACTCTGTTGCCCAGG + Intergenic
1011611132 6:89151417-89151439 ACAGGGTCACCATGTTGGCCAGG + Intronic
1011653536 6:89529078-89529100 ACAGGGTGACTCTCTTGTTAGGG - Intronic
1012304582 6:97637237-97637259 ACAGGCTGACTCTCTTGTGAAGG + Intergenic
1012727526 6:102834040-102834062 ACAGGCTGACTCTCTTGGTAAGG + Intergenic
1012911829 6:105126404-105126426 ACAGTGTTACTCTGTTGCCCAGG - Intronic
1013172745 6:107651740-107651762 ACAGGCTGACTCTCTTGGTAGGG + Intronic
1013209288 6:107972387-107972409 ACTGGGTGACTTTGATAGGCTGG + Intergenic
1013334491 6:109141404-109141426 ACAGGGTTTCACTGTTGGCCAGG + Intronic
1013559000 6:111285738-111285760 TCAGGGTGGTTCTTTTGGGCTGG + Intergenic
1014542310 6:122692034-122692056 ACAGGGAGACTCTGTTTGTTTGG - Intronic
1014546583 6:122743054-122743076 TCAGGGTGATTCTTTTGAGCTGG + Intergenic
1014805247 6:125821974-125821996 AAAGGTTGCCTCTGTGGGGCTGG - Intronic
1014953833 6:127592663-127592685 ACAGAGTCACTCTGTTGCCCAGG - Intergenic
1015285583 6:131483176-131483198 ACAGTCTCACTCTGTTGCGCAGG + Intergenic
1015876651 6:137829127-137829149 AGAGGGTGGCCCTGTTGGCCTGG - Intergenic
1015968665 6:138721523-138721545 ACAGTTTGACTCTGTTGCCCAGG + Intergenic
1017382109 6:153843146-153843168 ACAGGGTTTCACTGTTGGCCAGG - Intergenic
1017410311 6:154161234-154161256 ACAGAGTCACTCTGTTGCCCAGG + Intronic
1017499085 6:155006712-155006734 ACAGTGTTACTCTGTTGCCCAGG + Intronic
1018076537 6:160220995-160221017 ACAGGTTGACTCTCTTGTGAAGG - Intronic
1018079175 6:160244108-160244130 ACAGAGTCACTCTGTTGCCCAGG + Intronic
1018377153 6:163223874-163223896 ACAGAGTGATTCTGTTAGTCAGG + Intronic
1018718636 6:166555468-166555490 ACAGGGTGACTTCGTGGGACAGG - Intronic
1019024976 6:168952043-168952065 ACAGTGTGATTGTGTTGTGCAGG + Intergenic
1019141116 6:169943871-169943893 ACAGGATGACTGGATTGGGCTGG - Intergenic
1019748112 7:2712019-2712041 AGAGGCTCACTCTGTTGGCCAGG - Intronic
1019877440 7:3826749-3826771 GCAGGTTGAGTCTGTTGGTCAGG - Intronic
1020043575 7:5022719-5022741 TCAGGGTGATTCTTTTGAGCCGG + Intronic
1021065643 7:16169639-16169661 ACAGCGTGAGTCTGTTGCCCAGG + Intronic
1021839494 7:24711252-24711274 ACAGAGTCACTCTGTTGTCCAGG + Intronic
1023056651 7:36296003-36296025 ACAGTCTCACTCTGTTGGCCGGG - Intronic
1023530716 7:41150399-41150421 ACAGGCTGACACTGTTGAGCAGG - Intergenic
1023956472 7:44890655-44890677 ACAGGGTTTCACTGTTGGTCAGG + Intergenic
1024524853 7:50339277-50339299 AAAGGGTGAATCTATTGGGGAGG + Intronic
1025194966 7:56925476-56925498 ACAGGGTCACTCCGTTGGAAGGG + Intergenic
1025261524 7:57423101-57423123 ACATGGTGACTCTCTTGTGCAGG - Intergenic
1025676986 7:63651467-63651489 ACAGGGTCACTCCGTTGGAAGGG - Intergenic
1025736381 7:64151381-64151403 ACAGTGTTACTCTGTTGCCCAGG + Intronic
1025738847 7:64180289-64180311 ACATAGTGACTCTCTTGTGCAGG - Intronic
1026250220 7:68663377-68663399 ACAGGGTCTCTCTGTTGCTCAGG - Intergenic
1026428063 7:70316427-70316449 ACAGAGTCACTCTGTTGCCCAGG + Intronic
1026558928 7:71431981-71432003 ACAGTTTCACTATGTTGGGCAGG - Intronic
1026720304 7:72825075-72825097 ACAGGGTCTCTCTGTTGCCCAGG - Intronic
1026912461 7:74099104-74099126 CCAGGGTGACGGTGTGGGGCAGG - Exonic
1028082288 7:86592988-86593010 ACAGGCTGATTCTGTGGAGCAGG - Intergenic
1028203230 7:87987202-87987224 ACAGTCTCACTCTGTTGGCCAGG + Intronic
1029339453 7:99931251-99931273 ACAGGGTCACTATGTTGGCCGGG + Intergenic
1030057696 7:105597826-105597848 ACAGGGTCTCTCTGTTGCTCAGG + Intronic
1030593780 7:111511621-111511643 AGAGGGAGACTCTGTTGCCCAGG - Intronic
1030857836 7:114583350-114583372 ACAGGCTTACTCTGTTGCCCAGG - Intronic
1031070878 7:117160205-117160227 ACAGTTTCACTCTGTTGGTCAGG - Intronic
1032288864 7:130568083-130568105 ACAGGGTCACCATGTTGGCCAGG - Intronic
1032350568 7:131159165-131159187 ACAGGGTCTCTCTGTTGTCCAGG - Intronic
1032979342 7:137264084-137264106 TCAGGGTGATTCTTTAGGGCTGG + Intronic
1033201992 7:139381433-139381455 ACAGGGTCACACTCTTGGCCAGG + Intronic
1034289622 7:149919264-149919286 ACAGAGTCACTCTGTTGCCCAGG + Intergenic
1034661439 7:152773559-152773581 ACAGAGTCACTCTGTTGCCCAGG - Intronic
1035036115 7:155895520-155895542 ACAGGCTGACTCTCTTGTGAGGG + Intergenic
1035066898 7:156112137-156112159 ACAGGCTGACTCTCTTGTGAGGG - Intergenic
1035092325 7:156323991-156324013 ACAGGCTGACTCTCTTGTGAGGG - Intergenic
1035167029 7:156997338-156997360 ACAGGCTGACTCTCTTGTGAGGG - Intronic
1035262971 7:157673632-157673654 AGAGGGGGCCTCTGTGGGGCGGG - Intronic
1035262991 7:157673701-157673723 AGAGGGGGCCTCTGTGGGGCGGG - Intronic
1035533553 8:374397-374419 ACAGGGTGGATCTGCTGGCCAGG + Intergenic
1035533566 8:374467-374489 ACAGGGTGGATCTGCTGGACAGG + Intergenic
1035533586 8:374572-374594 ACAGGGTGGATCTGCTGGACAGG + Intergenic
1035533595 8:374607-374629 ACAGGGCGGATCTGTTGGGCAGG + Intergenic
1035533620 8:374747-374769 ACAGGGCGGATCTGTTGGACAGG + Intergenic
1035533627 8:374782-374804 ACAGGGTGGATCTGCTGGGCAGG + Intergenic
1035533645 8:374890-374912 ACAGGGTGGATCTGCTGGACAGG + Intergenic
1035533658 8:374960-374982 ACAGGGCGGATCTGCTGGGCAGG + Intergenic
1035533674 8:375065-375087 ACAGGGCGGATCTGCTGGGCAGG + Intergenic
1035533716 8:375310-375332 ACAGGGTGGATCTGCTGGACAGG + Intergenic
1035533728 8:375379-375401 ACAGGGTGGATCTGCTGGACAGG + Intergenic
1035533735 8:375413-375435 ACAGGGTGGATCTGCTGGGCAGG + Intergenic
1035533747 8:375483-375505 ACAGGGTGGATCTGCTGGACAGG + Intergenic
1035533758 8:375553-375575 ACAGGGTGGATCTGCTGGCCAGG + Intergenic
1035533778 8:375658-375680 ACAGGGTGGATCTGCTGGCCAGG + Intergenic
1037536246 8:19827305-19827327 AGAGGGAGACTCGTTTGGGCTGG - Intronic
1037792156 8:21954679-21954701 GCAGAGGGACACTGTTGGGCCGG - Intronic
1038209279 8:25500530-25500552 AAAGGGTCACTCTGTTGCCCAGG + Intronic
1038624117 8:29173594-29173616 ACAGGGTCTCTCTGTTGTCCAGG - Intronic
1039250249 8:35656059-35656081 ACAGGGTGACTCTTGAGGGAGGG - Intronic
1040051810 8:43022412-43022434 ACAGGGTTGCTGTGTTGGGTTGG + Exonic
1041374616 8:57201013-57201035 ACAGGGTCTCCCTGTTGCGCAGG + Intergenic
1041515769 8:58697305-58697327 TCAGGGTGATTCTTTTGAGCTGG - Intergenic
1042172291 8:66003819-66003841 ACAGATTGAGTCTGTTGAGCAGG - Intergenic
1042557804 8:70048358-70048380 ACCGGGTTTCTCTGTTGGTCAGG + Intergenic
1042923070 8:73939430-73939452 ACAGAGTCACTCTGTTGCCCAGG - Intronic
1043934674 8:86129775-86129797 AGAGGCTGACTCTGTTGCCCAGG - Intronic
1044116675 8:88344389-88344411 ACAGAGTCACTCTGTTGCCCAGG + Intergenic
1044625548 8:94232710-94232732 AAAGGGTGACACTGTCAGGCTGG + Intergenic
1045295909 8:100871632-100871654 ACAGGGTCTCTCTGTTGCCCAGG - Intergenic
1045462902 8:102441914-102441936 ACAGAGTCACTCTGTTGCCCAGG + Intergenic
1045805418 8:106155134-106155156 ACAGGGTCTCTCTGTTGTCCAGG - Intergenic
1047655616 8:126973856-126973878 ACAGTGTCACTCTGTTGCCCAGG + Intergenic
1048109159 8:131448286-131448308 ACAGAGTCACTCTGTTGCCCAGG + Intergenic
1048199511 8:132360178-132360200 ACAGGGAGGCTCTGAGGGGCTGG - Intronic
1049136779 8:140909155-140909177 ACAGCGAGACTCTGTTGGAAGGG + Intronic
1049586296 8:143434021-143434043 ACAGAATCACTCTGTTGGCCAGG - Intergenic
1050143884 9:2545030-2545052 ACAGGGTCTCTCTGTTGCTCAGG - Intergenic
1051165186 9:14254273-14254295 ACAGTGTCACTCTGTTGCCCAGG - Intronic
1051654573 9:19366576-19366598 ACAGAGTCACTCTGTTGCCCAGG - Intronic
1051780763 9:20686180-20686202 ACAGGGTCACTCTGTCGCCCAGG + Intronic
1052015097 9:23453906-23453928 ACAGAGTAAATCTGTTGGGTCGG - Intergenic
1052935439 9:34089085-34089107 ACAGGGTCACTCTGTTGCCCAGG - Intronic
1053225199 9:36348954-36348976 ACAGGCTGACTCTTTTTGGGGGG + Intronic
1055311133 9:74981703-74981725 ACAGGTTGACACTGGTGGGTTGG - Exonic
1056375996 9:86011548-86011570 ACAGGTTCACCCTGTTGGCCAGG + Intronic
1056907452 9:90665911-90665933 ACAGGGTAGCTGTGCTGGGCTGG + Intergenic
1057238709 9:93389704-93389726 ACAGGGTCTCTCTGTTGCCCAGG + Intergenic
1057388259 9:94623008-94623030 ACAGTGTCACTCTGTTGTCCAGG + Intronic
1057787890 9:98101609-98101631 ACAGGGAGTCACTGTTGGCCAGG + Intronic
1058155437 9:101509381-101509403 ACAGGTTGAATTTGTTGAGCAGG + Intronic
1058845544 9:108954986-108955008 ACAGTCTTACTCTGTTGGCCAGG + Intronic
1058903279 9:109460308-109460330 ACATGGTGGCTGTGTGGGGCTGG - Intronic
1059454121 9:114388924-114388946 AGAGACTGACTCTGTTGGCCTGG - Intronic
1059483417 9:114609662-114609684 ACAGGGTCACTCTCTTGCCCAGG - Intergenic
1059900177 9:118915754-118915776 ACTGGGTTGCTCTGTTGGCCAGG - Intergenic
1060207309 9:121689678-121689700 ACAGGGAGCTTCTGTTGGGTAGG - Intronic
1060322044 9:122571522-122571544 ACAGTCTGGCTCTGTTGGCCAGG - Intergenic
1060322171 9:122572517-122572539 ACAGGGTGAGTGTATGGGGCTGG + Intergenic
1060855414 9:126911046-126911068 ACAGTCTCACTCTGTTGTGCAGG - Intergenic
1061059593 9:128243751-128243773 ACCGGGTGACACTGTGGGGGAGG + Intronic
1061863682 9:133480716-133480738 ACAGGGTCACTTTGTTGCCCAGG - Intergenic
1061904414 9:133689323-133689345 ACAGGGTGGCTCTGCTGGACTGG - Intronic
1062076006 9:134590349-134590371 CAAGGGTGGCTCTGCTGGGCTGG + Intergenic
1062515337 9:136931240-136931262 ACAGGGTCTCTCTGTTGTCCAGG + Intronic
1186667371 X:11731424-11731446 ACAGAGTCACTCTGTTGCCCAGG - Intergenic
1186969812 X:14829404-14829426 ACAGGCTGACTCTCTTGGTAGGG - Intergenic
1187337907 X:18396794-18396816 ACAGGGTCTCTCTGTTGCCCAGG + Intergenic
1188360546 X:29247590-29247612 ACAGGGTTTCACTGTTGGCCAGG - Intronic
1189288581 X:39869358-39869380 ACAGGGTCTCTCTTCTGGGCTGG + Intergenic
1190834692 X:54089768-54089790 ACGGGGTTTCTCTGTTGGTCGGG - Intronic
1192915169 X:75644226-75644248 GCAGGGTGATTCTTTTGGGCTGG + Intergenic
1194295251 X:92119129-92119151 ACAGGGTCTCTCTGTTGCTCAGG + Intronic
1194384693 X:93238090-93238112 TCAGGGTGATTCTTTTGAGCTGG - Intergenic
1194723342 X:97365889-97365911 ACAGGGTTACCATGTTGGCCAGG + Intronic
1195430587 X:104785036-104785058 ACAGTCTGACTCTGTTGCCCAGG + Intronic
1196832565 X:119787674-119787696 ACAGGGTCACACTGTTGCCCAGG + Intronic
1197327472 X:125111375-125111397 ACTGTGTCACTGTGTTGGGCAGG - Intergenic
1197979445 X:132199897-132199919 ACAGGGTTTCGCTGTTGGCCAGG - Intergenic
1198080564 X:133235615-133235637 ACAGGGTCTCTCTGTTGCCCAGG + Intergenic
1198091183 X:133331733-133331755 ACAGTCTCACTCTGTTGGCCAGG - Intronic
1198461850 X:136870913-136870935 ACAGGGTTTCACTGTTGGCCAGG - Intronic
1198823123 X:140669990-140670012 ACAGAGTCACTCTGTTGCCCAGG - Intergenic
1198970379 X:142272375-142272397 TCAGGGTGGTTCTTTTGGGCCGG - Intergenic
1199087143 X:143640378-143640400 ACAGGGTCACTCTGTCGCTCAGG - Intergenic
1199225593 X:145369341-145369363 ACAGGGTTACCATGTTGGCCAGG + Intergenic
1200612750 Y:5343641-5343663 ACAGGGTCTCTCTGTTGCCCAGG + Intronic
1200977900 Y:9232139-9232161 ACAGGGTCTCTCTGTTGCCCAGG - Intergenic
1201270615 Y:12250411-12250433 TCAGGGTGGTTCTTTTGGGCTGG - Intergenic
1201327736 Y:12782697-12782719 ACAGGCTGACTCTGTTGTTAGGG - Intronic
1202132908 Y:21630770-21630792 ACAGGGTCTCTCTGTTGCCCAGG + Intergenic