ID: 907268820

View in Genome Browser
Species Human (GRCh38)
Location 1:53278399-53278421
Sequence CGCCCCCACGTGGAAAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907268820_907268824 7 Left 907268820 1:53278399-53278421 CCAGATCTTTCCACGTGGGGGCG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 907268824 1:53278429-53278451 TCTGTGTTTTCACTTTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907268820 Original CRISPR CGCCCCCACGTGGAAAGATC TGG (reversed) Intronic
901196960 1:7445583-7445605 CCCTCCCAGGTGGAAAGACCTGG + Intronic
907268820 1:53278399-53278421 CGCCCCCACGTGGAAAGATCTGG - Intronic
915033990 1:152907441-152907463 AGCCCCCAGGTGGAGAGCTCTGG + Intergenic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
1079115153 11:17635809-17635831 CGCCCCCAGGTGGTGAGCTCTGG + Intronic
1089139026 11:116271741-116271763 GGCCCCCACCTGGGAAGTTCTGG - Intergenic
1090634749 11:128683952-128683974 ACCCCCCACGTGGGGAGATCTGG + Intergenic
1091047247 11:132335492-132335514 TGCCCCCACGTGGAACATTCTGG + Exonic
1091194306 11:133718408-133718430 GGACCCCAGGTGGAAAGACCAGG - Intergenic
1104678541 12:130732305-130732327 CGGCGCCACGTGGAATGAGCAGG + Intergenic
1105813775 13:24015705-24015727 CGCCCCAAAGGGGAAGGATCAGG - Intronic
1117653490 14:57930444-57930466 CACCACCACGTGGAAACACCAGG + Intronic
1127502630 15:59569111-59569133 CACCCCCAAGAGGAAGGATCTGG - Intergenic
1127565814 15:60187125-60187147 CGCCCCCACATGGGACCATCTGG + Intergenic
1129144766 15:73636652-73636674 CGCCCCCTGGTGGAAAGGTCTGG + Intergenic
1132808121 16:1785088-1785110 GTCCACCACGTGGAATGATCTGG + Intronic
1163528279 19:17834664-17834686 GGCCCCCAAGTGGACAGAGCTGG - Exonic
1163535459 19:17874001-17874023 GGCCCCCACGTGCAAGAATCTGG + Intronic
1163728939 19:18938919-18938941 CACCCCCACTTAGAAAGCTCAGG + Intronic
1167681203 19:50922576-50922598 TGTCCCCAGGTGGAAAGCTCTGG - Intergenic
1169001704 20:2172725-2172747 CGCCCCCTCCTGGAAAGATTGGG + Intronic
1172793119 20:37519772-37519794 TGCCCCCACGTGGTAAGGACAGG + Intronic
1176063739 20:63183509-63183531 CGCCCTCACGTGGTAAGTACAGG - Intergenic
1181283292 22:21735323-21735345 CGCCCCGCCGTGAAAAGATAGGG - Intronic
968547967 4:1208235-1208257 GGCCCCCACGGGGCAAGTTCTGG + Intronic
969132968 4:5004974-5004996 CCTCCACACGTGGAAAGAGCTGG + Intergenic
994005374 5:94830707-94830729 CACCCCCATGTGGAAACATGAGG - Intronic
1019811902 7:3171080-3171102 CGACCCCATGAGGAAAGAGCTGG - Intronic
1039032835 8:33328476-33328498 CACCCCCATGTGAAAAGCTCTGG - Intergenic
1047029432 8:120861125-120861147 TGCCCACAAGTGGAAAGCTCGGG + Intergenic
1062175010 9:135156787-135156809 CGCCGTCACGTGGATAGAGCTGG - Intergenic
1190214917 X:48473701-48473723 TGCCCCCACCGGGAAAGAGCTGG + Intergenic
1192549820 X:72045034-72045056 AGCCCCCACGTGGAGCTATCTGG + Intergenic
1194353858 X:92856263-92856285 TACCCACAAGTGGAAAGATCTGG - Intergenic
1195352329 X:104007062-104007084 CACCCCTCTGTGGAAAGATCTGG - Intergenic
1200662218 Y:5973335-5973357 TACCCACAAGTGGAAAGATCTGG - Intergenic