ID: 907268957

View in Genome Browser
Species Human (GRCh38)
Location 1:53279376-53279398
Sequence TGCAGTAGCGGCCTTCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907268950_907268957 3 Left 907268950 1:53279350-53279372 CCCTAGTTGGAGAGACTCCCATC 0: 1
1: 0
2: 2
3: 3
4: 68
Right 907268957 1:53279376-53279398 TGCAGTAGCGGCCTTCATATTGG 0: 1
1: 0
2: 0
3: 2
4: 31
907268947_907268957 17 Left 907268947 1:53279336-53279358 CCTATTCCAACATGCCCTAGTTG No data
Right 907268957 1:53279376-53279398 TGCAGTAGCGGCCTTCATATTGG 0: 1
1: 0
2: 0
3: 2
4: 31
907268949_907268957 11 Left 907268949 1:53279342-53279364 CCAACATGCCCTAGTTGGAGAGA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 907268957 1:53279376-53279398 TGCAGTAGCGGCCTTCATATTGG 0: 1
1: 0
2: 0
3: 2
4: 31
907268951_907268957 2 Left 907268951 1:53279351-53279373 CCTAGTTGGAGAGACTCCCATCC No data
Right 907268957 1:53279376-53279398 TGCAGTAGCGGCCTTCATATTGG 0: 1
1: 0
2: 0
3: 2
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907268957 Original CRISPR TGCAGTAGCGGCCTTCATAT TGG Intronic
904442945 1:30543529-30543551 AGCAGTAGCAGCCTTGATAAGGG - Intergenic
907268957 1:53279376-53279398 TGCAGTAGCGGCCTTCATATTGG + Intronic
908660918 1:66434364-66434386 GGCAGTAGCAGCCTTCCTACAGG - Intergenic
909149743 1:71986956-71986978 TGCAATATCTGCCTTGATATTGG + Intronic
911127770 1:94356709-94356731 TGCAGTACAGCCTTTCATATTGG + Intergenic
924095011 1:240542075-240542097 TTCAGTAGCAGCCGTCATAGTGG - Intronic
1072201148 10:93160013-93160035 TGCAGTAGTGGGCTTCTAATGGG + Intergenic
1085621312 11:78039800-78039822 TACAGAAGAGCCCTTCATATGGG - Intronic
1109706169 13:66095272-66095294 TGCAGAAGTGGCTTTCATATTGG + Intergenic
1111991349 13:95120513-95120535 TGCAGTAGCATCCATCATCTTGG - Intronic
1116260103 14:42613897-42613919 TGCAGTAGGGGCTTGCCTATTGG + Intergenic
1120231947 14:81849703-81849725 TGCAGAAGCGGCTTTGAGATTGG - Intergenic
1130534087 15:84770813-84770835 TCCAGCAGCGGCCTTCAGACAGG + Intronic
1139598148 16:67969699-67969721 CACAGTAGCGGCCTTCCTACTGG + Intergenic
1140220245 16:73038486-73038508 TGCAGTTGTGGCCGTCATATTGG - Intronic
1148991998 17:51674086-51674108 AGCAGTAGAGGCCTTAATAGAGG - Intronic
943673853 2:190697236-190697258 TTCAGTAGCTGCCTTCAGAAAGG - Intergenic
1175444612 20:59011428-59011450 TGCAGTGCAGGCCTTCAGATAGG + Intergenic
1185013067 22:48326932-48326954 TGCAGTAGCAGCCTCTATTTTGG + Intergenic
950364289 3:12472038-12472060 TGGAGGAACGGCCTCCATATGGG - Intergenic
956529183 3:70198981-70199003 TATAGTAGTGGTCTTCATATTGG - Intergenic
970500889 4:16676032-16676054 CCCAGTAGAGGCCTTCATGTGGG - Intronic
976362700 4:84198555-84198577 TGCAATAAAGGTCTTCATATGGG + Intergenic
985926189 5:3020902-3020924 TGCAGTGGCGTCATTCATCTGGG - Intergenic
987785688 5:22495497-22495519 TTCAGTAGCAGCTTCCATATGGG + Intronic
988961171 5:36373022-36373044 TGCTTTAGAGGCCTTCATCTGGG + Intergenic
998918257 5:147039639-147039661 TGCAGAAGTTGCCTTCAAATTGG - Intronic
1011730480 6:90257698-90257720 TGAAGTAGCAGCCTACAGATTGG - Intronic
1021981256 7:26057864-26057886 TGCAGTAGCATCTTTCATCTGGG + Intergenic
1026553439 7:71386938-71386960 TTCAGTAGATGCCTTCATTTGGG + Intronic
1026553603 7:71387916-71387938 TTCAGTAGATGCCTTCATTTGGG - Intronic
1026589668 7:71684046-71684068 TGCAGTAGCAGCCTTAGTGTTGG + Intronic
1052828669 9:33197040-33197062 TGGAGAAGCTGCCTTCATAGAGG - Intergenic
1052904032 9:33817910-33817932 TGAAGTAGCCGCCTTCGTAGAGG - Exonic