ID: 907272137

View in Genome Browser
Species Human (GRCh38)
Location 1:53297411-53297433
Sequence GTGTCCTGACAGTAGGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907272131_907272137 1 Left 907272131 1:53297387-53297409 CCCAGAAGGCGAACGGTTCCCAC 0: 1
1: 0
2: 0
3: 3
4: 29
Right 907272137 1:53297411-53297433 GTGTCCTGACAGTAGGGTGCAGG No data
907272132_907272137 0 Left 907272132 1:53297388-53297410 CCAGAAGGCGAACGGTTCCCACA 0: 1
1: 0
2: 0
3: 4
4: 33
Right 907272137 1:53297411-53297433 GTGTCCTGACAGTAGGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907272137 Original CRISPR GTGTCCTGACAGTAGGGTGC AGG Intronic
No off target data available for this crispr