ID: 907275355

View in Genome Browser
Species Human (GRCh38)
Location 1:53313944-53313966
Sequence TCCAGGAAGGGCATGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 316}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907275355 Original CRISPR TCCAGGAAGGGCATGGCAGT GGG Intronic
900474786 1:2870955-2870977 TCCAGGCAGACCCTGGCAGTGGG - Intergenic
900598635 1:3493731-3493753 CCCAGGAAGGGCGTGGGTGTGGG - Intronic
900851411 1:5145947-5145969 TACAGGAAGGGGAATGCAGTGGG + Intergenic
901177390 1:7314365-7314387 TCCAGGGAGGGCCTTGCAATGGG + Intronic
901200335 1:7463247-7463269 CCCAGGCAGGGCATGGGAGGTGG + Intronic
901218902 1:7571046-7571068 TCCATGAAGGTGAAGGCAGTTGG - Intronic
901344764 1:8530120-8530142 TCTGGGAAGGCCTTGGCAGTTGG - Intronic
901881613 1:12197409-12197431 TTCAGGAAGGTCTTGGGAGTTGG - Intronic
904606507 1:31700845-31700867 TCCAGGAAGGGCATATTAATGGG + Intronic
904693164 1:32310092-32310114 TCCAGAAAGGATCTGGCAGTTGG + Intronic
905252282 1:36657320-36657342 TCCAGGCAGGGCATGGCCTCAGG + Intergenic
906004669 1:42458024-42458046 TCCAGGTGGAGTATGGCAGTAGG + Intronic
906659013 1:47569227-47569249 CCCAGGAAGGGCATAGCTGGAGG - Intergenic
907275355 1:53313944-53313966 TCCAGGAAGGGCATGGCAGTGGG + Intronic
908916059 1:69127875-69127897 TCCAGGATGGGCGTGACACTAGG - Intergenic
909395501 1:75167111-75167133 TGCAGGAATGGCATGGCAGTAGG + Intergenic
910371077 1:86515823-86515845 TACTGGTAGGGCATGGAAGTGGG + Intergenic
911157132 1:94647805-94647827 TCCATGAAGGTCATGGATGTAGG - Intergenic
912205423 1:107503187-107503209 TCAAGGTAGGGCATGGCAAAAGG - Intergenic
912587098 1:110777106-110777128 TCCAGGAAAGGCCTGGCAAATGG - Intergenic
916175345 1:162033518-162033540 GCAAGGAAGGGGCTGGCAGTTGG - Intergenic
916575942 1:166066489-166066511 TAGTGGAAGGGCATGGAAGTTGG + Intronic
917912277 1:179662113-179662135 TCCAGGCATGGCATTCCAGTGGG - Exonic
917928856 1:179810236-179810258 ACCATGAAGGGCATTGCAATAGG + Intronic
918071733 1:181138226-181138248 TCCAGGATGGACATGCCATTGGG + Intergenic
918447486 1:184629796-184629818 TCCTGGAAGGCCAGTGCAGTGGG - Intergenic
920266833 1:204730286-204730308 TCAAGGGAGGCCATGGCAGTAGG + Intergenic
920763765 1:208811434-208811456 TCCAGGCAAGAGATGGCAGTTGG - Intergenic
922368976 1:224890875-224890897 TCCTGCAGGTGCATGGCAGTTGG - Intergenic
924884609 1:248200908-248200930 TCTAGGAAGAGCAAGGGAGTTGG - Intergenic
1063364326 10:5480659-5480681 TCCAGGGAGGGGAAGGCAGGAGG - Intergenic
1063490467 10:6459090-6459112 TCCAGGAAAGGCACAGCAATAGG - Intronic
1063580808 10:7304937-7304959 TCCAGAAACAGCATGGCAGGAGG + Intronic
1063702593 10:8400133-8400155 TATAGGAAGGGCTTGGGAGTGGG + Intergenic
1064674134 10:17744661-17744683 TGCAGGAAGGAAATGACAGTTGG + Intergenic
1066313003 10:34216427-34216449 TCCAGGAAGGCAGTGGCACTAGG - Intronic
1066363478 10:34753643-34753665 TCCCTGGAGGGCATGGCAGAGGG + Intronic
1066429860 10:35341202-35341224 TCCAGGAAGGGCAAGGAAGGAGG - Intronic
1067079638 10:43205789-43205811 TGCAGGAGGGGCAGGGCAGTGGG - Intronic
1068268554 10:54687830-54687852 TCAAGGATGGGCATGGTAATAGG - Intronic
1070591616 10:77805902-77805924 GGCAGGAAGGGCAGGGCAGCAGG - Intronic
1071138827 10:82483067-82483089 TCCAGGAAAGGCAGGGCAGATGG + Intronic
1071435567 10:85645985-85646007 ACCATGAAGGGCAGGGCGGTGGG + Intronic
1071917963 10:90317323-90317345 CAGAGGAAGGGCATGCCAGTGGG - Intergenic
1072241191 10:93496768-93496790 GCCAGGGAGGGCAGGTCAGTGGG + Exonic
1072797632 10:98368100-98368122 GCCAGGAAAGGCTTAGCAGTTGG - Intergenic
1073645074 10:105293530-105293552 TCCAGGAAGGGGATGTCAACAGG - Intergenic
1074102400 10:110364161-110364183 TGCAGGAAGGGCATGGTGGGCGG + Intergenic
1075055936 10:119218308-119218330 TCCAGGAAGGGAAGGGGAGGGGG + Intronic
1076804163 10:132846889-132846911 TCCATGAAGGGCCTGGCTGGAGG + Intronic
1078522503 11:12074535-12074557 TCCAAGCAGAGCATGTCAGTTGG + Intergenic
1078741409 11:14069917-14069939 TCCAGGAAGCCCAAGACAGTGGG - Intronic
1078922777 11:15845694-15845716 TCCAGGAAAATCTTGGCAGTAGG - Intergenic
1079276386 11:19041087-19041109 TCCAGGAAGGGCACAGAACTGGG + Intergenic
1079638398 11:22773927-22773949 TCTAGGAAGTGCATGCCAGGTGG - Intronic
1080869511 11:36225293-36225315 TCCAGCTAGGCCATGACAGTAGG + Intronic
1081338744 11:41901759-41901781 TACAGGAAAGTCATGGCAATAGG + Intergenic
1081568629 11:44276038-44276060 CCCAGGGAGGCCATGGCACTGGG - Intronic
1081747130 11:45481248-45481270 TCCAGTAAGGACATGCCTGTTGG - Intergenic
1083490980 11:63014945-63014967 TCCGAGAAGGTCATGGCACTGGG + Exonic
1083550935 11:63589828-63589850 GCCAGGGAGGGCTTGGCAATGGG + Intronic
1084030176 11:66476415-66476437 CCCAGGAAGGGCAAGGCCATGGG - Exonic
1084646868 11:70463954-70463976 TCGAGGAAGGGCAGGGCTGCCGG - Intergenic
1084797964 11:71520864-71520886 TCCAGGGAGGCCAAGGCAGGAGG - Intronic
1085019014 11:73193395-73193417 ACAAGCAAGGGTATGGCAGTAGG - Intergenic
1085481853 11:76829641-76829663 TGCAGGAAGAGCTTGGCAATGGG + Intergenic
1085758451 11:79221122-79221144 TCCTGAAGGGGCATGGCAGCGGG + Intronic
1088383264 11:109220727-109220749 TCCAGGAAGGGCACAGAACTGGG - Intergenic
1089508983 11:118983814-118983836 TCCAGGGAGGCCAAGGCAGGTGG - Intergenic
1090634467 11:128682137-128682159 TCCAAGAAGGGCACTCCAGTAGG - Intergenic
1090680032 11:129045810-129045832 TCCAGGAAGAGAATGGAAGATGG + Intronic
1092024296 12:5227940-5227962 TCCAGGAAGGGCTGGGCAGCAGG - Intergenic
1096544748 12:52330193-52330215 TACAGGGAGGGCATGACATTGGG + Intergenic
1097937443 12:65269636-65269658 TCCAGAAACTGTATGGCAGTGGG - Intergenic
1100682593 12:96944197-96944219 ACCAGGAAGGCCAAGCCAGTTGG + Intronic
1101064160 12:101002086-101002108 TCCACTAAGGCAATGGCAGTGGG - Intronic
1101542221 12:105675647-105675669 TACAGGAAGGGCTTGGCAGATGG + Intergenic
1101616698 12:106344894-106344916 TGCAGGAAGGGCAGGGAAGGTGG + Intronic
1102488316 12:113273135-113273157 TCAAGGCAGGGCATGCCAGGTGG + Intronic
1104706809 12:130953831-130953853 CCCAGGAAGGACACAGCAGTGGG + Intergenic
1107939844 13:45373900-45373922 TGAAGGAAGGGAATGGCACTGGG + Intergenic
1108016625 13:46083522-46083544 ACCAGGAAGGTACTGGCAGTTGG + Intronic
1109313696 13:60725277-60725299 GGAAGGAAAGGCATGGCAGTTGG - Intergenic
1110466456 13:75807282-75807304 TCCAGGAAAGTCATGGGTGTTGG + Intronic
1112152992 13:96784750-96784772 TTGAGGAAGGGCTTGGCAGAAGG - Intronic
1113238918 13:108314842-108314864 TCAAAGAAGAGCATGGCAATGGG - Intergenic
1113798944 13:113076723-113076745 TTCAGGAAGGGCCTGGCCCTGGG + Intronic
1115448234 14:33516829-33516851 GCCAGGCAGGGCAGGGCAATTGG - Intronic
1119383735 14:74244437-74244459 TCGAGGAAGGGCAGGGGAGGAGG + Intronic
1120752378 14:88209714-88209736 TCCAGGAAGGGTAGGACAGAGGG + Intronic
1122832191 14:104403907-104403929 CCCAGGAAGGGCAGGACAGGTGG + Intergenic
1124355653 15:28993061-28993083 TGCAGGAATGGCCAGGCAGTGGG + Intronic
1125530735 15:40411855-40411877 TCCAGGAAGTCCAGGGCAGATGG + Intronic
1126480176 15:49110555-49110577 TGTAGGCAGGGCATGTCAGTGGG - Intronic
1129121674 15:73401243-73401265 TCCAGGAAGAGCAGGGGAGCTGG - Intergenic
1130120372 15:81042486-81042508 CCCAGGAAAAGCATGGCAATGGG - Intronic
1130429797 15:83835533-83835555 TCCAGGAAGGGCGTGGGCTTAGG - Intronic
1131894268 15:97008511-97008533 TCCAGGAAGAGCAGGGAAATAGG - Intergenic
1132365337 15:101252358-101252380 GGCAGGAAGGGCGTGGCCGTGGG - Intergenic
1134826201 16:17286329-17286351 TCATGGAAGGGGATGGCAGATGG + Intronic
1137623888 16:49895442-49895464 TCCAGGCAGGGCAGGGAAGTGGG + Intergenic
1138470058 16:57227337-57227359 TCCAGGAAGGCTACGGCATTGGG + Exonic
1140364544 16:74371086-74371108 TCCAGCACCGGCATGGCTGTGGG + Intergenic
1140478197 16:75249416-75249438 GCCAGGAAGGGCCTGACAGAGGG + Intronic
1141032790 16:80604166-80604188 GCCAGGAAGGGCAGGGAGGTGGG + Exonic
1142252820 16:89000509-89000531 TCCGGGAAGGACAGGGCCGTGGG + Intergenic
1142534116 17:601853-601875 TCCAGGAAGGGATTGGTAGATGG + Exonic
1145768902 17:27478649-27478671 TGCAGGAAGGGCAAGGAGGTCGG - Intronic
1146651424 17:34609223-34609245 TTCAGGAAAGGCAGGGCAGCCGG - Intronic
1147660390 17:42114056-42114078 TCCATGAAGGGCCAGGCACTGGG + Exonic
1148206930 17:45784901-45784923 TGCAGGAAGGGCGTGGGAGGTGG - Intronic
1148652010 17:49257073-49257095 TCCAGGGAGGTCATGGCAGGTGG - Intergenic
1148670890 17:49409248-49409270 GGCAGGAAGCGCTTGGCAGTGGG - Intronic
1148724481 17:49778894-49778916 TGCAATAAGAGCATGGCAGTGGG + Intronic
1150143063 17:62746191-62746213 CCCCAGGAGGGCATGGCAGTGGG + Intronic
1150765631 17:67999604-67999626 TCAAGGAAGGGAATGCCAGTTGG - Intergenic
1152524382 17:80879282-80879304 GCCGGGAAGGACATGGCAGGTGG - Intronic
1153844165 18:9033438-9033460 TCCAGCAAAGCCATGGTAGTGGG + Intergenic
1156131997 18:33987794-33987816 AGAAGGAAGGGCATAGCAGTAGG + Intronic
1156992143 18:43421765-43421787 TCAAAGCAGGGCATGGCAGCAGG - Intergenic
1157688558 18:49662462-49662484 GCCAGGAAGGGCATGGCCTGAGG + Intergenic
1160081198 18:75728875-75728897 TCCAGGAAGGGCATGAGGGCAGG - Intergenic
1160402072 18:78618570-78618592 GGCAGGAAGGGCTTGGCAGCAGG - Intergenic
1161545547 19:4878176-4878198 TCCAGGGAGGGATTGGCTGTGGG - Intergenic
1161682229 19:5686097-5686119 TCAAGGAAGGGTATGGCTCTTGG + Intronic
1163181896 19:15609905-15609927 TCCAGCAGGGGCATCCCAGTTGG + Intergenic
1163478150 19:17539170-17539192 TCCAGGAAGGCCCGGGCAGCAGG - Exonic
1163551612 19:17968724-17968746 TCCAGGGAGGGTGTGGAAGTGGG + Intronic
1163831296 19:19548283-19548305 GCCAGGAAGGGCATCTCAGGAGG + Intergenic
1163995919 19:21047358-21047380 TCCAGGAAGGGCACAGAACTGGG - Intronic
1165326775 19:35118652-35118674 ACCGGGAAGGGCATGGGTGTGGG + Intronic
1165894318 19:39132326-39132348 TCTGGGAAGGGCCTGGCAGGCGG - Intronic
1166293879 19:41879537-41879559 TCCAGGAAGGGCCTGGGGGGCGG - Exonic
1168311313 19:55462178-55462200 TCCAGGAAGGGGCTGGCTGAGGG + Intronic
925013854 2:506936-506958 TCCTGGAAGCCCAAGGCAGTAGG + Intergenic
925917275 2:8615682-8615704 TCTGGGAAGGTCTTGGCAGTTGG - Intergenic
927906845 2:26864717-26864739 TGCAGGAAGGGCCAGGCACTTGG + Intronic
928495915 2:31831866-31831888 TCCAAGATAGGCATGGCATTTGG + Intergenic
928607243 2:32954129-32954151 TCCAGGAAGCCCAGGGCAGTAGG - Intronic
929396962 2:41534199-41534221 TCCAGAAAGGGCAGGGCTCTGGG + Intergenic
930020249 2:46997534-46997556 TCCAGGACAGGTATGGCTGTTGG + Intronic
932887984 2:75564231-75564253 TACAGGAAGGGCAGAGGAGTAGG + Intronic
934050015 2:88201994-88202016 TGCAGGAAGGGGACGGTAGTTGG + Intergenic
934553056 2:95274041-95274063 TTCAGGATTGGCCTGGCAGTGGG + Intergenic
935669261 2:105541436-105541458 ACAAGGAAGGCCATGGGAGTGGG - Intergenic
936171635 2:110181755-110181777 TCCAGCAAGGGCACAGAAGTGGG + Intronic
937094331 2:119225586-119225608 TCCAAGAAGGGAAGGGCTGTGGG - Intronic
937253634 2:120539941-120539963 GCCAGGGAGGACAGGGCAGTGGG + Intergenic
937955773 2:127421082-127421104 CCCAGGAAGCAGATGGCAGTTGG - Intronic
938395577 2:130945275-130945297 TGCAGGAAGTGTATGGCAGAGGG - Intronic
939940052 2:148338563-148338585 TTCAGGAAAGACATGTCAGTGGG + Intronic
941008445 2:160270710-160270732 GCCATGAAGGGTGTGGCAGTGGG + Intronic
941301516 2:163808437-163808459 TGGAGGAAGGGCCTGGCAGGAGG + Intergenic
942089624 2:172477062-172477084 TCCAGTGAGAGCAAGGCAGTTGG - Intronic
943335841 2:186612527-186612549 TCCTAGAAGGGCCTGGCTGTAGG + Intronic
946212804 2:218161145-218161167 TCCAGGATGGGGCTGGCACTAGG - Intergenic
946308173 2:218867999-218868021 TCCAGAAGGGGCGTGGCAGGGGG - Intronic
948519692 2:238528027-238528049 GGCAGGAAGTGCATGGCATTAGG + Intergenic
948759874 2:240183870-240183892 GCCAGGAAGGGCGGGGCAGGGGG + Intergenic
948952965 2:241266707-241266729 TCTAGAAAGGGCATGGGATTTGG + Intronic
1172554191 20:35826536-35826558 TCCAGGAAGAGAGTGGCAGGGGG + Intronic
1172759203 20:37310162-37310184 TCCAGGATGCGCTTGGCAGGCGG - Intronic
1172894957 20:38294056-38294078 CCTAGGAGGGGCATGGCAGAAGG - Intronic
1174407155 20:50310002-50310024 TTCAGGAAGAGCCTGGCATTAGG - Intergenic
1175235756 20:57509900-57509922 GCCAGGCAGGTCATGGCCGTGGG - Intronic
1175405533 20:58723506-58723528 TCCAGGATGGCCAAGGCAGCTGG + Intergenic
1175458070 20:59130131-59130153 GCTAGGAAGGGCCTGGCACTTGG + Intergenic
1175830859 20:61965111-61965133 TGCAGGCAGGGCAGGGCAGGCGG - Intronic
1176523067 21:7839197-7839219 TCCAGCAAGGGCATGGAACTAGG + Intergenic
1178413799 21:32387490-32387512 GGAAGGCAGGGCATGGCAGTGGG + Intronic
1178657087 21:34469209-34469231 TCCAGCAAGGGCATGGAACTAGG + Intergenic
1179429255 21:41308398-41308420 TGGAGGAAGAGCATGGAAGTTGG - Intronic
1180723004 22:17923337-17923359 CCCAGAGAGGTCATGGCAGTTGG - Intronic
1181646097 22:24232469-24232491 TCCTGGGAGGGCCTGTCAGTGGG + Intronic
1182303653 22:29353141-29353163 TTCTGGAAGGGCATAGGAGTAGG - Intronic
1182357958 22:29730703-29730725 TCCAGGGCGGGGATGGCAGATGG + Exonic
1182423665 22:30260610-30260632 TCAAGGAAGAGCAGGGCAGGTGG - Intergenic
1183481046 22:38065707-38065729 TCCAGGACTGGAATGGCAGGCGG + Intronic
1183619979 22:38966586-38966608 TCCTGGAAGGGCAGGCCTGTGGG + Intronic
1184096023 22:42316954-42316976 TCCAGGAAGAGAAAAGCAGTGGG - Intronic
1184391429 22:44205671-44205693 AACAGGAAGGGCTTGGCACTTGG + Intronic
1184552757 22:45213320-45213342 GCCAGGCAGGGCATGGGAGTGGG - Intronic
1184641116 22:45870756-45870778 TCCAGGAAGATCAAGGCAGCTGG + Intergenic
1185316372 22:50180955-50180977 TCCAGGAGGGGCCTGGCGATGGG - Intergenic
950764227 3:15261442-15261464 GCCAGGAGGGGCTGGGCAGTTGG - Intronic
951957655 3:28275116-28275138 TCCAGCAAGGGCATAGAACTGGG - Intronic
953040669 3:39252603-39252625 TTCATGGAGGGTATGGCAGTTGG - Intergenic
953114683 3:39980345-39980367 CCCAGGATGGGCATGGCCCTTGG + Intronic
954195466 3:48994262-48994284 TCCAAGAACAGCATGGCAGAGGG - Intronic
954571554 3:51645211-51645233 TCCAAGCAGGGCATGTCAGGTGG + Exonic
954891809 3:53937424-53937446 TCCAGGCAGGGGAAGGCAGCTGG + Intergenic
954946855 3:54433671-54433693 TTGAGGAAGAGCATGGCTGTGGG + Intronic
956248926 3:67215228-67215250 TCCATGCAGGGAGTGGCAGTGGG + Intergenic
959133763 3:102391364-102391386 TCAAGGAAGGGAATGGGAGATGG - Intronic
962096220 3:132295656-132295678 ACCAGGAAGGACATGGCACTTGG + Intergenic
962935270 3:140074849-140074871 GCCAGGGAAGGCATTGCAGTGGG - Intronic
962998844 3:140657048-140657070 TCCAGCAAGGGCATAGAACTGGG + Intergenic
963044542 3:141093038-141093060 TCTGGGAAGGGGGTGGCAGTGGG + Intronic
964751670 3:160059368-160059390 GCCAGGAAGAGCAGGGCATTAGG + Intergenic
964826124 3:160829870-160829892 GCCAGGAAAGGCATGCCAATGGG - Intronic
965734190 3:171803490-171803512 TCCTGGAAGGCCAAGGCAGGAGG + Intronic
967121567 3:186386989-186387011 TCCAGGAAAGGCATGGGGGCTGG + Intergenic
967136361 3:186516024-186516046 TTCACCAAGGGCAGGGCAGTGGG - Intergenic
967866572 3:194194848-194194870 TCCTGGAAGGGTGTGGCAGCTGG - Intergenic
967956545 3:194881599-194881621 TTCAGAAAGGGCGTGCCAGTTGG - Intergenic
968863074 4:3188131-3188153 CTCAGGCAGGGCAGGGCAGTGGG + Intronic
969269103 4:6086678-6086700 TCCAGGAAGGCCATGGGTCTTGG - Intronic
969469952 4:7381852-7381874 TCCAGGATGGGCAGTACAGTGGG + Intronic
972769124 4:42179788-42179810 GGCAGGAATGGGATGGCAGTGGG + Intergenic
973211192 4:47617512-47617534 TCCATAGAGGGCAGGGCAGTGGG + Intronic
974913121 4:68147888-68147910 TCCAGCAAGGGCATAGAACTGGG - Intergenic
975374331 4:73626038-73626060 GACAGGAAGGGCAGGGCAGAGGG - Intergenic
978416099 4:108477656-108477678 TCCAGGAAGAGCTGGGCAGAAGG - Intergenic
978493326 4:109332694-109332716 ATCAGGAGGGGCCTGGCAGTGGG + Intergenic
980874226 4:138644844-138644866 TCCAGGAAGGGCACTACAGGAGG - Intergenic
981019202 4:140007490-140007512 TCCAGTAAAGGGAGGGCAGTGGG + Intronic
982560654 4:156925142-156925164 TTCAGGAAGGAAATGTCAGTTGG + Intronic
982640254 4:157949993-157950015 TTCAGGAAGGTCTTAGCAGTAGG - Intergenic
982991408 4:162280989-162281011 TGCAGGAGGGGCCTGGCAGAAGG + Intergenic
985641139 5:1063981-1064003 GACAGGGAGGGCATGGCTGTGGG + Intronic
985951057 5:3221636-3221658 CCCAGGAAGAGCAGGGCAGAGGG + Intergenic
986637085 5:9834084-9834106 TCCAGGTAGGGCCTGGAAGGGGG - Intergenic
986988970 5:13529560-13529582 AACAGCAAGGGCAGGGCAGTAGG + Intergenic
991631441 5:68660504-68660526 CCCACGAAGGGCAAGGAAGTCGG + Intergenic
994380137 5:99060984-99061006 GCTAGGAAAGGAATGGCAGTCGG - Intergenic
995233777 5:109801320-109801342 AGGAGGAAGGTCATGGCAGTTGG + Intronic
998016143 5:138733908-138733930 CCCTGGAAGGGCAGAGCAGTCGG + Intronic
998957224 5:147451198-147451220 AAAAGGAAGGGCATGGCAGGAGG - Intronic
999264412 5:150256978-150257000 GACAGGAAGGGCATTGCAGCAGG - Intronic
1000720001 5:164694057-164694079 TCCAGCAAGGGCATAGAATTGGG + Intergenic
1001749158 5:174115654-174115676 TCCAGGAAGGACATGACTGGTGG + Intronic
1001863481 5:175081303-175081325 TCCTGGAAGGGCAGAGAAGTGGG - Intergenic
1003359610 6:5412243-5412265 CCCAGGAAGGGCATGTCTTTGGG - Intronic
1003889703 6:10553226-10553248 TCCAGGCAGGGCGTGCCAGCTGG - Intronic
1005471199 6:26164264-26164286 TCCAGGATGGGCTGGCCAGTGGG - Intronic
1005528654 6:26678967-26678989 TCCAGGAAGAGAATTCCAGTGGG - Intergenic
1005542142 6:26822681-26822703 TCCAGGAAGAGAATTCCAGTGGG + Intergenic
1005753999 6:28909423-28909445 TCCTGGAAGGTCATGGAATTGGG - Intronic
1006621755 6:35370196-35370218 GCCAGGAAGGGTCTGGCTGTTGG + Intronic
1006678397 6:35779691-35779713 TGCAGGAAGGGAATGGCACAGGG + Intergenic
1007334231 6:41140223-41140245 TCCAGGCAGGGCCTAGCACTAGG - Intergenic
1008484046 6:52016049-52016071 ACCAGGAAGTACATGTCAGTAGG - Intronic
1009012946 6:57864732-57864754 TCCAGGAAGAGAATTCCAGTGGG + Intergenic
1009707014 6:67265595-67265617 TCCAGCAAGGGCATAGAACTGGG - Intergenic
1010967559 6:82229243-82229265 TTCAGGTAAGGCAAGGCAGTGGG - Intronic
1011079555 6:83474450-83474472 TGCTGGAATAGCATGGCAGTAGG + Intergenic
1013602856 6:111721158-111721180 GCCTGGAAGGGCAGGGCAGTCGG - Intronic
1014044642 6:116871547-116871569 TCCAGGAAAGGAATCCCAGTTGG - Intergenic
1015554332 6:134445350-134445372 GCCTGGAAGGGCATGGCAATGGG - Intergenic
1015917161 6:138228833-138228855 TGCAGGCAGGGCATGGCTGTGGG + Intronic
1016913851 6:149226252-149226274 TCCAGTGAAGGCATGGCTGTAGG + Intronic
1017052321 6:150405208-150405230 ACCAGGGAGGGCCTGGCAGATGG - Intronic
1017182341 6:151565154-151565176 TGCAGGTGGGGTATGGCAGTGGG + Intronic
1018578376 6:165283943-165283965 TCCAGCAAGGGCATAGAACTGGG + Intronic
1018632874 6:165835604-165835626 TCCAGGGAGGGCTTTGCAGTTGG + Intronic
1019563992 7:1670723-1670745 TCCGGGAAGGGAAGGGCAGGGGG - Intergenic
1019733180 7:2638483-2638505 TCCAGGAATGGCCTGGAAGGAGG - Intronic
1019866193 7:3712660-3712682 TTCCTGAAGCGCATGGCAGTGGG + Intronic
1020118627 7:5490526-5490548 TCCAGAAAGGGCCTGACAGCAGG + Intronic
1020968463 7:14902787-14902809 TTCTGGAAGGGGGTGGCAGTGGG - Intronic
1022342922 7:29485899-29485921 TCCTGGAAGTGCATGGGGGTGGG - Intronic
1022625636 7:32033106-32033128 CCCAGGCAGGGCAAGGCAGAAGG + Intronic
1022840636 7:34160870-34160892 TCCAGCTAGAGCCTGGCAGTTGG + Intergenic
1023591172 7:41782188-41782210 GCCATGAAGGGCATAGCAGAGGG + Intergenic
1023917189 7:44598180-44598202 TCCAGGAAGGGCACAGCATTAGG + Intergenic
1024990434 7:55231114-55231136 TCCAGGAAGGGCACAGAACTGGG - Intronic
1026414991 7:70170393-70170415 ACCAGGAAGGCCAAGGCAGGCGG - Intronic
1026659432 7:72286675-72286697 TCCTGCAGGGGCATGCCAGTTGG + Intronic
1027869694 7:83691334-83691356 TCCATGCAGGGCATGGGGGTTGG + Intergenic
1027958919 7:84919095-84919117 TGCAGGAAGGGCATGGTGGGAGG - Intergenic
1029374129 7:100167770-100167792 TCCAGGAGTGGCATTGCAATGGG + Intronic
1029641964 7:101826662-101826684 TGCAGGAAGGGCTTGGAAGGCGG + Intronic
1029737693 7:102473760-102473782 TCCAGGAAGGGCCTGGCGGGGGG - Intronic
1029912815 7:104173362-104173384 TTGAGGATGGGCATTGCAGTGGG - Intronic
1031532183 7:122887901-122887923 TTCAGTAAGAGCATGGCTGTGGG + Intergenic
1032014974 7:128373503-128373525 TCCAGGAAGGTCAAAGCAATGGG + Intergenic
1032069320 7:128794130-128794152 TCCAGGAAGGGCCTGGGAGGTGG + Intronic
1032785471 7:135196522-135196544 TCCAGGAAGGGGCTGTCAGGAGG - Intronic
1034060404 7:148082112-148082134 TTAAAGAAGGGCATTGCAGTAGG + Intronic
1034163387 7:149008126-149008148 TCCAGGGCTGGCATGGCAGAGGG + Intronic
1034487924 7:151377628-151377650 AGCAGGAAGGTCAGGGCAGTGGG - Exonic
1035182023 7:157096487-157096509 GCCTGGAAGGGGATGGCAGCAGG + Intergenic
1036528328 8:9556133-9556155 TGCCGGAGGGGGATGGCAGTCGG + Exonic
1036711030 8:11078700-11078722 TCCAGGAAGGTGCTAGCAGTTGG + Intronic
1037477697 8:19273679-19273701 TGCGGGAAGTGCATGGCTGTGGG - Intergenic
1038617180 8:29105493-29105515 CCCAGCCAGGGCATGGCAGAGGG - Intronic
1043377981 8:79671296-79671318 TCGAGGTAGGGCCTGGCAGGAGG - Intergenic
1044508444 8:93048529-93048551 TCCAGGAAGGGCACAGAAATGGG - Intergenic
1046020566 8:108659843-108659865 TCCAGGAACGGCATGGTCTTAGG - Intronic
1046732840 8:117744227-117744249 TCCTGGACTGGCATGGCAGCAGG - Intergenic
1047238206 8:123061015-123061037 TCCAGGAAGGGTTTGGGAGAGGG + Intronic
1047428073 8:124765015-124765037 TCCAGGGAGGCCAAGGCAGGAGG - Intergenic
1048402797 8:134087662-134087684 TCCAGGAAGGGAAGGGAAGTAGG + Intergenic
1049151909 8:141040534-141040556 TACAGGAAGGGCCAAGCAGTGGG - Intergenic
1049651725 8:143772686-143772708 TCCAGGAAGGGAATGGCGCACGG - Intergenic
1049710057 8:144059382-144059404 TCCAGGGTGGGCATGGCGGCAGG + Intronic
1050093963 9:2044322-2044344 TCCAGGGAGCACATGGCAGGCGG + Intronic
1050322419 9:4466842-4466864 TCCAGGAAGTGCAAGGGGGTCGG + Intergenic
1051324000 9:15944791-15944813 TCTAGGCAGAGCATGGTAGTTGG + Intronic
1051524878 9:18032152-18032174 TCCAGGAAGGGTGTAGCTGTTGG - Intergenic
1055895808 9:81174408-81174430 TCCAGGACTAGCATGACAGTGGG - Intergenic
1057078273 9:92152561-92152583 TCTAGGATCGGCCTGGCAGTTGG - Intergenic
1057721408 9:97534947-97534969 TTGAGCAAAGGCATGGCAGTGGG + Intronic
1058514231 9:105752785-105752807 TGCAGCAAGGGCATGGAACTAGG + Intronic
1059076430 9:111198005-111198027 TCCAGCAAAGGCATGGAACTGGG + Intergenic
1059543031 9:115149168-115149190 GCCATGAGGGGCATGGCAGAAGG - Intronic
1061260685 9:129479263-129479285 TCCAGGATGGGCAAGGCACAGGG - Intergenic
1061936212 9:133858999-133859021 CCCAGGATGGGCAGAGCAGTCGG - Intronic
1062044542 9:134418955-134418977 TCCAGAAAGGGCAGGGAAGCAGG - Intronic
1062096450 9:134706314-134706336 TGCAGGAAGGGGAAGGCAGAGGG + Intronic
1185556981 X:1029295-1029317 TCCAGGAAGAGCTTGGAAGATGG - Intergenic
1187765886 X:22641547-22641569 TACAGGAAAGGGATGGCAGCTGG - Intergenic
1188671974 X:32891608-32891630 ACCATGAAGGTCATGACAGTTGG - Intronic
1188742025 X:33796284-33796306 CCCAGGAAGGGCATGGTCTTTGG + Intergenic
1189301838 X:39957947-39957969 TGCAGGAAGGGCATGTCAGACGG + Intergenic
1190282342 X:48939317-48939339 CCCAGGAAAGGCATGGGAGAGGG + Intronic
1191701702 X:64048819-64048841 TCCAGGAAGGACACAGAAGTTGG + Intergenic
1192189683 X:68983279-68983301 AACAGGAAGGGCATGGCACAGGG + Intergenic
1192433852 X:71130210-71130232 TCCAGGTAGGCCAAGGCCGTGGG + Exonic
1192670900 X:73140138-73140160 TCCAGGAATGTGCTGGCAGTAGG - Intergenic
1193844711 X:86454796-86454818 TCCAGCAAGGGCACAGAAGTGGG - Intronic
1195072368 X:101292782-101292804 TCCAGGAAGGGAAAGGTAGGTGG - Exonic
1195153544 X:102098188-102098210 TCCAGCAAGGGCATAGAAGTGGG + Intergenic
1196032182 X:111102882-111102904 TCCAGAAAGGGCACGGAAGTGGG - Intronic
1197318003 X:124992220-124992242 TCCAGGACAGTCTTGGCAGTGGG - Intergenic
1197703111 X:129614882-129614904 CCCAGGAGGGGCATGGGGGTGGG - Intergenic
1197718438 X:129727377-129727399 TCCAGGTAGGGAAGGTCAGTAGG + Intergenic
1198167702 X:134073531-134073553 TCCAGTAAAGGAATGGCGGTGGG - Intergenic
1199296998 X:146170714-146170736 TCACGGAAGGGCATTACAGTGGG - Intergenic
1199840735 X:151645089-151645111 TTCAGACAGGGCATGGTAGTGGG + Intronic
1199871308 X:151901235-151901257 TGCAAGAAGGGCAGGCCAGTTGG - Intergenic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201692586 Y:16783994-16784016 TTCAGCAGGGGCTTGGCAGTGGG - Intergenic
1201696431 Y:16832055-16832077 ACCAGGAAGGAAGTGGCAGTTGG + Intergenic
1201955836 Y:19621537-19621559 TCTAGGAAAGGCTTGCCAGTGGG + Intergenic