ID: 907275808

View in Genome Browser
Species Human (GRCh38)
Location 1:53316054-53316076
Sequence AAGAAGAACCGACTGGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907275801_907275808 16 Left 907275801 1:53316015-53316037 CCACTCTGCCCTGGTTTGCTTGG 0: 1
1: 0
2: 2
3: 26
4: 284
Right 907275808 1:53316054-53316076 AAGAAGAACCGACTGGCTCATGG 0: 1
1: 0
2: 1
3: 3
4: 111
907275804_907275808 7 Left 907275804 1:53316024-53316046 CCTGGTTTGCTTGGTCCAATTCA 0: 1
1: 0
2: 0
3: 16
4: 137
Right 907275808 1:53316054-53316076 AAGAAGAACCGACTGGCTCATGG 0: 1
1: 0
2: 1
3: 3
4: 111
907275800_907275808 21 Left 907275800 1:53316010-53316032 CCAGACCACTCTGCCCTGGTTTG No data
Right 907275808 1:53316054-53316076 AAGAAGAACCGACTGGCTCATGG 0: 1
1: 0
2: 1
3: 3
4: 111
907275806_907275808 -8 Left 907275806 1:53316039-53316061 CCAATTCAGTGGTGTAAGAAGAA 0: 1
1: 0
2: 0
3: 14
4: 196
Right 907275808 1:53316054-53316076 AAGAAGAACCGACTGGCTCATGG 0: 1
1: 0
2: 1
3: 3
4: 111
907275803_907275808 8 Left 907275803 1:53316023-53316045 CCCTGGTTTGCTTGGTCCAATTC 0: 1
1: 0
2: 0
3: 4
4: 105
Right 907275808 1:53316054-53316076 AAGAAGAACCGACTGGCTCATGG 0: 1
1: 0
2: 1
3: 3
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907275808 Original CRISPR AAGAAGAACCGACTGGCTCA TGG Intronic
900706273 1:4082247-4082269 AGGAAGAACAGACTCCCTCAGGG - Intergenic
902608325 1:17581859-17581881 AAGAAGAACCCCGAGGCTCAGGG - Intronic
903623260 1:24713490-24713512 AAGAAGAAGTGACTTGCCCAAGG + Intergenic
904787497 1:32993753-32993775 AAGATGAACTGACTTGCCCAAGG - Intergenic
907275808 1:53316054-53316076 AAGAAGAACCGACTGGCTCATGG + Intronic
912511147 1:110190907-110190929 AAGATGAAATGACTTGCTCAAGG - Intronic
912944344 1:114072294-114072316 AACAAGAACAGCCAGGCTCAAGG - Intergenic
915856681 1:159396331-159396353 AATAAGAACCACCAGGCTCAGGG + Intergenic
921263246 1:213402189-213402211 AAGAATAAGTGAGTGGCTCAAGG - Intergenic
924657040 1:245981987-245982009 AAGAAGACCCCACGTGCTCAAGG - Intronic
1062829964 10:598914-598936 AAGTAGAAAAGACTGCCTCAAGG + Intronic
1062940922 10:1420950-1420972 AAGGAGAACCGAGCGGCGCAGGG - Intronic
1063522524 10:6753791-6753813 AGGCAGAAGCGCCTGGCTCATGG - Intergenic
1067365021 10:45618725-45618747 AAGAATAAATGACTTGCTCATGG - Intronic
1068267144 10:54666310-54666332 GAGAATAAGTGACTGGCTCAAGG + Intronic
1068971707 10:62965150-62965172 AAAAATAACTGACTAGCTCATGG - Intergenic
1069390857 10:67932984-67933006 AAGAATAACTGAATGCCTCATGG - Intronic
1069859173 10:71459813-71459835 AAGAAGAACAGGCTGCCTCCAGG - Intronic
1071965162 10:90844760-90844782 AAAAAGATCAGTCTGGCTCAGGG + Intronic
1074055625 10:109921240-109921262 AAGATCAAATGACTGGCTCAAGG + Intronic
1075976240 10:126698010-126698032 GAGAGGAACCCATTGGCTCAAGG + Intergenic
1076930034 10:133525981-133526003 ATGTAGACTCGACTGGCTCACGG - Intronic
1078752179 11:14175745-14175767 CAGAAGAACCGAGTGGCTTCTGG + Intronic
1078793307 11:14566903-14566925 CAGAGGAACTGACTGGCTCCAGG - Intronic
1080881845 11:36328595-36328617 AAAAAGATCTGATTGGCTCATGG - Intronic
1082047414 11:47741157-47741179 AAGAAAAACAGACTGGCGCACGG - Intronic
1085772619 11:79338717-79338739 AATATCAAGCGACTGGCTCAAGG - Intronic
1087829444 11:102803115-102803137 AAAAAGAATTGACTGGTTCAAGG - Intergenic
1089426364 11:118379411-118379433 AAGCAGAAGAGACTGGGTCAGGG - Intronic
1094398415 12:30034160-30034182 CAGAAGATCAGACTGGCACATGG - Intergenic
1094566914 12:31607150-31607172 AGGAAGAACAGGCTGTCTCAGGG - Intergenic
1096385265 12:51191095-51191117 AAGAATAAGCGCATGGCTCAGGG - Intronic
1097956276 12:65488805-65488827 AAGAAAAAGTGACTGGCCCAAGG + Intergenic
1107608216 13:42083649-42083671 AAGAAGCAACGAGTTGCTCAGGG - Intronic
1108267823 13:48730159-48730181 AGGAAAAACAGAGTGGCTCATGG + Intergenic
1110278304 13:73662930-73662952 ATGAATAACTGACTGGCTAATGG - Intergenic
1111665709 13:91266212-91266234 AAGAAAAACCTACTGACACAAGG - Intergenic
1112370066 13:98786206-98786228 AAGCACTGCCGACTGGCTCATGG - Intergenic
1115455274 14:33594698-33594720 CAGAAGGACCGACTGCCTCTTGG + Intronic
1118067548 14:62208232-62208254 AACAAAAACCTATTGGCTCATGG + Intergenic
1122777455 14:104127372-104127394 CAGACGTACCAACTGGCTCAGGG + Intergenic
1129362226 15:75031063-75031085 AAAAAGAACGGACTTGCCCAGGG - Intronic
1137723657 16:50642446-50642468 AAGATGAGCAGACTGGCCCATGG + Intergenic
1140896081 16:79325456-79325478 GAGAGGAAGCAACTGGCTCAGGG + Intergenic
1143182094 17:4989656-4989678 AAGAAGAACTGGCTCTCTCAAGG + Intronic
1146496297 17:33325475-33325497 AAGAAGGCCTGACTGGCTGAAGG + Intronic
1152546448 17:81002482-81002504 ATGAACAATCAACTGGCTCACGG + Intronic
1153027886 18:687798-687820 AAGAGGAACAGCCTGGCTCTTGG + Intronic
1153326042 18:3821312-3821334 AAGATGAAACGACTTGCCCAAGG + Intronic
1153624487 18:7011260-7011282 AGGAAGCACCGACTGGCTCTCGG + Intronic
1155381571 18:25227660-25227682 AAGATGATCCGACTTGCTCTTGG - Exonic
1158620180 18:59026163-59026185 GAGATGAAGCGACTTGCTCAGGG + Intergenic
1158914330 18:62106385-62106407 AAAAAAAACTGAGTGGCTCAGGG + Intronic
927921490 2:26975416-26975438 GAGAATTACAGACTGGCTCAAGG + Intronic
929370600 2:41219872-41219894 AATAAGAAACAAATGGCTCAAGG - Intergenic
937019387 2:118636272-118636294 AAACAGAAGCTACTGGCTCAAGG - Intergenic
941441910 2:165548732-165548754 AAAAAGAACAGACTGGTTCCTGG - Intronic
946890814 2:224274310-224274332 AAGAAGGAACCAGTGGCTCATGG - Intergenic
1171052447 20:21872409-21872431 AAAGAGAAGAGACTGGCTCATGG - Intergenic
1177097451 21:16854245-16854267 AAGAATAACTGACTGGGTCTGGG - Intergenic
1178105550 21:29315269-29315291 AACAGGAACTGACTGGCTTAGGG + Intronic
1179597852 21:42455080-42455102 AAGGAGAACAAAATGGCTCAAGG - Intergenic
1181014162 22:20059245-20059267 AAAAAGTACCAACTGGCTCGAGG - Intronic
1181347002 22:22226719-22226741 AATAAGAAGGGACTGTCTCAGGG - Intergenic
1181508653 22:23378961-23378983 AAGAACCAGAGACTGGCTCATGG + Intergenic
1184742920 22:46439522-46439544 AAGAAAACCCGACTGACTCCAGG + Intronic
949702209 3:6771851-6771873 AAAAGGAAGTGACTGGCTCAAGG + Intronic
952567096 3:34672121-34672143 AAGAAGCACCCAGTGGCTCATGG + Intergenic
956946316 3:74227293-74227315 AAGAAGGACAGACTAGATCATGG - Intergenic
958916316 3:100054444-100054466 AAGCAGGTCAGACTGGCTCATGG - Intronic
967857366 3:194128594-194128616 AGGAAGAAGCGACTTGCACAGGG - Intergenic
973661787 4:53115326-53115348 AAGAAGAAAAGACTGAGTCAGGG + Intronic
978938243 4:114405171-114405193 AAAAAGAACTGCCTGTCTCAGGG - Intergenic
979828244 4:125267184-125267206 AAGAAGAAACGACTGGCTAATGG - Intergenic
981031629 4:140131315-140131337 AAGATGAAGTGACTTGCTCAAGG + Intronic
981480744 4:145236627-145236649 AAGAAGAAATGAATGACTCAGGG + Intergenic
986417849 5:7546453-7546475 GAGATGAAGCGACTGGCCCAGGG + Intronic
988849788 5:35169148-35169170 ACGAAGAACTGAATGACTCAAGG + Intronic
990331536 5:54731048-54731070 AAGAAGCACCATCTGCCTCATGG + Intergenic
990468147 5:56088524-56088546 ATCAAGAACCCTCTGGCTCAGGG + Intergenic
992701615 5:79346640-79346662 AAGAAGAGCCCCCTGGCTCTGGG + Intergenic
996508127 5:124290042-124290064 AAGAAGGAACATCTGGCTCAGGG - Intergenic
999340557 5:150766993-150767015 AAGAAGAAGGGACTTCCTCAAGG + Intergenic
1001950837 5:175815323-175815345 AATGAGAACCGACTCACTCAGGG + Intronic
1002062050 5:176630800-176630822 AAGGAGAGCCGAGTAGCTCAAGG - Exonic
1004456970 6:15800359-15800381 AAGAACAAGTGACTTGCTCAAGG + Intergenic
1004821783 6:19375203-19375225 AAGCAGAGCTGAGTGGCTCATGG + Intergenic
1009432220 6:63577321-63577343 AAGAAAAACCAACTGGTTTATGG - Intronic
1010934137 6:81840353-81840375 GAGATGAGCTGACTGGCTCATGG - Intergenic
1012386393 6:98688308-98688330 AAGAAGAAATGACTGGCCAAGGG - Intergenic
1012426519 6:99121181-99121203 AAGAAGAGCAGACAGGGTCAAGG - Intergenic
1018964958 6:168477884-168477906 AAGAAGAATCGAGTGGGTCGCGG - Intronic
1022392449 7:29955288-29955310 AAGCAGACCCGCCTGGCTCTGGG - Exonic
1023485845 7:40685710-40685732 AAGAATAACCAACTAGCACAAGG - Intronic
1027146652 7:75700261-75700283 AGGAAGAGCTGACGGGCTCATGG - Intronic
1027262070 7:76471825-76471847 ACCAAGAACCCACTGGCTCCTGG - Intronic
1027313451 7:76969920-76969942 ACCAAGAACCCACTGGCTCCTGG - Intergenic
1035390653 7:158502139-158502161 AAGAAGAACTGGCTTGCTCTGGG + Intronic
1035954860 8:4065896-4065918 AAGAAGAACAAAGTGGCCCAGGG + Intronic
1036241596 8:7086241-7086263 AAGAAGAGCAGTCTGGCTGAAGG - Intergenic
1038608599 8:29036808-29036830 AGAAAGAACTGACTTGCTCAAGG - Intronic
1042623072 8:70727491-70727513 AAGAAGAATCGACTGAATCCGGG - Intronic
1046515169 8:115249990-115250012 TAGAAGAAGCGACTGACTTAAGG - Intergenic
1046798615 8:118399443-118399465 AAGAAGAGCCACCTTGCTCAAGG + Intronic
1051681084 9:19608951-19608973 CAGAGGAACCAGCTGGCTCAGGG - Intronic
1052138181 9:24941973-24941995 AAGAAGAGCAGACTGGTTCTGGG + Intergenic
1052395271 9:27930863-27930885 AAGGAGAATCCCCTGGCTCAGGG - Intergenic
1052603188 9:30665621-30665643 AACAAGAACAGACTGGATCTAGG + Intergenic
1053443997 9:38137493-38137515 AAGAGGAACCGTCTGTCTCTTGG - Intergenic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1189761653 X:44328091-44328113 AAGTTGAAACCACTGGCTCACGG + Intronic
1189996904 X:46647511-46647533 AACAAGAAGAGAATGGCTCAGGG - Intronic
1191863169 X:65682521-65682543 ACGAAGAAGGGACTTGCTCAAGG + Intronic
1198176978 X:134166176-134166198 AGGAAGAAATGACTTGCTCAAGG - Intergenic
1199785929 X:151104850-151104872 AAAGAGAACCGTCTGGGTCAAGG + Intergenic
1200046596 X:153406266-153406288 AACAGGAACAGACTGGCTGATGG + Intergenic