ID: 907277400

View in Genome Browser
Species Human (GRCh38)
Location 1:53324459-53324481
Sequence TCTATGTGCACAGCCAGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907277393_907277400 8 Left 907277393 1:53324428-53324450 CCATCCGTTCCCTTCTTGCCAGC 0: 1
1: 0
2: 0
3: 28
4: 335
Right 907277400 1:53324459-53324481 TCTATGTGCACAGCCAGCGTTGG No data
907277396_907277400 -2 Left 907277396 1:53324438-53324460 CCTTCTTGCCAGCCCTGTGTGTC 0: 1
1: 0
2: 2
3: 35
4: 280
Right 907277400 1:53324459-53324481 TCTATGTGCACAGCCAGCGTTGG No data
907277397_907277400 -10 Left 907277397 1:53324446-53324468 CCAGCCCTGTGTGTCTATGTGCA 0: 1
1: 0
2: 5
3: 22
4: 294
Right 907277400 1:53324459-53324481 TCTATGTGCACAGCCAGCGTTGG No data
907277395_907277400 -1 Left 907277395 1:53324437-53324459 CCCTTCTTGCCAGCCCTGTGTGT No data
Right 907277400 1:53324459-53324481 TCTATGTGCACAGCCAGCGTTGG No data
907277394_907277400 4 Left 907277394 1:53324432-53324454 CCGTTCCCTTCTTGCCAGCCCTG 0: 1
1: 0
2: 5
3: 79
4: 625
Right 907277400 1:53324459-53324481 TCTATGTGCACAGCCAGCGTTGG No data
907277392_907277400 30 Left 907277392 1:53324406-53324428 CCGTGGAGGTGGGAACACTCATC 0: 1
1: 0
2: 1
3: 8
4: 134
Right 907277400 1:53324459-53324481 TCTATGTGCACAGCCAGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907277400 Original CRISPR TCTATGTGCACAGCCAGCGT TGG Intronic
No off target data available for this crispr