ID: 907278455

View in Genome Browser
Species Human (GRCh38)
Location 1:53329432-53329454
Sequence GTCAGGGACCTCTCCGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907278455_907278466 21 Left 907278455 1:53329432-53329454 CCAGCCCCGGAGAGGTCCCTGAC No data
Right 907278466 1:53329476-53329498 GCACACAGACAACGAAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907278455 Original CRISPR GTCAGGGACCTCTCCGGGGC TGG (reversed) Intergenic