ID: 907278456

View in Genome Browser
Species Human (GRCh38)
Location 1:53329436-53329458
Sequence ACAGGTCAGGGACCTCTCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907278456_907278466 17 Left 907278456 1:53329436-53329458 CCCCGGAGAGGTCCCTGACCTGT No data
Right 907278466 1:53329476-53329498 GCACACAGACAACGAAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907278456 Original CRISPR ACAGGTCAGGGACCTCTCCG GGG (reversed) Intergenic