ID: 907278458

View in Genome Browser
Species Human (GRCh38)
Location 1:53329438-53329460
Sequence CCACAGGTCAGGGACCTCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907278458_907278466 15 Left 907278458 1:53329438-53329460 CCGGAGAGGTCCCTGACCTGTGG No data
Right 907278466 1:53329476-53329498 GCACACAGACAACGAAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907278458 Original CRISPR CCACAGGTCAGGGACCTCTC CGG (reversed) Intergenic