ID: 907278462

View in Genome Browser
Species Human (GRCh38)
Location 1:53329448-53329470
Sequence GTCTGTCTCCCCACAGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907278462_907278466 5 Left 907278462 1:53329448-53329470 CCCTGACCTGTGGGGAGACAGAC No data
Right 907278466 1:53329476-53329498 GCACACAGACAACGAAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907278462 Original CRISPR GTCTGTCTCCCCACAGGTCA GGG (reversed) Intergenic