ID: 907278463

View in Genome Browser
Species Human (GRCh38)
Location 1:53329449-53329471
Sequence GGTCTGTCTCCCCACAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907278463_907278466 4 Left 907278463 1:53329449-53329471 CCTGACCTGTGGGGAGACAGACC No data
Right 907278466 1:53329476-53329498 GCACACAGACAACGAAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907278463 Original CRISPR GGTCTGTCTCCCCACAGGTC AGG (reversed) Intergenic