ID: 907278464

View in Genome Browser
Species Human (GRCh38)
Location 1:53329454-53329476
Sequence CTAATGGTCTGTCTCCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907278464_907278466 -1 Left 907278464 1:53329454-53329476 CCTGTGGGGAGACAGACCATTAG No data
Right 907278466 1:53329476-53329498 GCACACAGACAACGAAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907278464 Original CRISPR CTAATGGTCTGTCTCCCCAC AGG (reversed) Intergenic