ID: 907278466

View in Genome Browser
Species Human (GRCh38)
Location 1:53329476-53329498
Sequence GCACACAGACAACGAAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907278462_907278466 5 Left 907278462 1:53329448-53329470 CCCTGACCTGTGGGGAGACAGAC No data
Right 907278466 1:53329476-53329498 GCACACAGACAACGAAATGCAGG No data
907278458_907278466 15 Left 907278458 1:53329438-53329460 CCGGAGAGGTCCCTGACCTGTGG No data
Right 907278466 1:53329476-53329498 GCACACAGACAACGAAATGCAGG No data
907278464_907278466 -1 Left 907278464 1:53329454-53329476 CCTGTGGGGAGACAGACCATTAG No data
Right 907278466 1:53329476-53329498 GCACACAGACAACGAAATGCAGG No data
907278455_907278466 21 Left 907278455 1:53329432-53329454 CCAGCCCCGGAGAGGTCCCTGAC No data
Right 907278466 1:53329476-53329498 GCACACAGACAACGAAATGCAGG No data
907278457_907278466 16 Left 907278457 1:53329437-53329459 CCCGGAGAGGTCCCTGACCTGTG No data
Right 907278466 1:53329476-53329498 GCACACAGACAACGAAATGCAGG No data
907278463_907278466 4 Left 907278463 1:53329449-53329471 CCTGACCTGTGGGGAGACAGACC No data
Right 907278466 1:53329476-53329498 GCACACAGACAACGAAATGCAGG No data
907278456_907278466 17 Left 907278456 1:53329436-53329458 CCCCGGAGAGGTCCCTGACCTGT No data
Right 907278466 1:53329476-53329498 GCACACAGACAACGAAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907278466 Original CRISPR GCACACAGACAACGAAATGC AGG Intergenic