ID: 907278527

View in Genome Browser
Species Human (GRCh38)
Location 1:53329854-53329876
Sequence GTGCCTCAGGTGAGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 1, 2: 2, 3: 36, 4: 319}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907278521_907278527 -1 Left 907278521 1:53329832-53329854 CCTGATGACAGGGAAGGAGTGGG 0: 1
1: 0
2: 1
3: 24
4: 277
Right 907278527 1:53329854-53329876 GTGCCTCAGGTGAGGCTGGAGGG 0: 1
1: 1
2: 2
3: 36
4: 319
907278518_907278527 5 Left 907278518 1:53329826-53329848 CCGGGGCCTGATGACAGGGAAGG 0: 1
1: 0
2: 2
3: 30
4: 329
Right 907278527 1:53329854-53329876 GTGCCTCAGGTGAGGCTGGAGGG 0: 1
1: 1
2: 2
3: 36
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907278527 Original CRISPR GTGCCTCAGGTGAGGCTGGA GGG Intergenic
900567316 1:3339897-3339919 GTGCAGCAGCTGAGGTTGGAAGG + Intronic
901399748 1:9007580-9007602 GCTCATCAGGTGAGGCTGGAGGG - Intronic
901904673 1:12397914-12397936 GAGGCTCAGGTGAGGATGGTAGG + Intronic
902020643 1:13342828-13342850 GTGGCTCAGGCCAGGCAGGATGG + Exonic
903399523 1:23030582-23030604 CTTCCTCAGGTGGGGCTTGAGGG - Exonic
903536639 1:24071310-24071332 GTGCTCAAGGTGGGGCTGGAAGG - Intronic
904315563 1:29658058-29658080 CTGGCTCAGCTGGGGCTGGATGG - Intergenic
904483140 1:30806611-30806633 GTGGGGCAGCTGAGGCTGGACGG - Intergenic
904565042 1:31423859-31423881 GTGCCCCAGGGGAGGCAGGGCGG + Intronic
905121917 1:35688901-35688923 GTGGCCCAGGTGAGGCTGGATGG + Intergenic
905196231 1:36279990-36280012 GTGCCAACGGTGAGGCTGGGCGG + Intronic
905343762 1:37297405-37297427 GTACCTCAGGTGAGACTTGATGG - Intergenic
907278527 1:53329854-53329876 GTGCCTCAGGTGAGGCTGGAGGG + Intergenic
907326641 1:53642651-53642673 TTAGCTCATGTGAGGCTGGAAGG - Intronic
908251200 1:62267375-62267397 AGGCCTCAGGTGAGGCTTAAGGG + Intronic
908755403 1:67464947-67464969 ATGCCCCAGTTGAGGCTTGATGG - Intergenic
912566625 1:110592193-110592215 GTGCCTCAGGTCAGGTGGGGAGG + Intergenic
913209675 1:116571799-116571821 CTGCCTCAGCTTGGGCTGGATGG - Intergenic
913327316 1:117638234-117638256 GTGCCTCACCTGAGGCTAGAAGG - Intergenic
913480785 1:119287163-119287185 GTGCTTCAGCTGAGGTTAGATGG - Intergenic
913588565 1:120300329-120300351 TTGCCTCAGGTCAGCTTGGAAGG - Intergenic
913619620 1:120598040-120598062 TTGCCTCAGGTCAGCTTGGAAGG + Intergenic
914570586 1:148912200-148912222 TTGCCTCAGGTCAGCTTGGAAGG - Intronic
914602246 1:149218069-149218091 TTGCCTCAGGTCAGCTTGGAAGG + Intergenic
915466344 1:156100542-156100564 GTGCCCCAGGCTAGGTTGGAGGG + Intronic
915946732 1:160158188-160158210 GTTCCTCAGCTGGGGCTGGATGG + Intronic
916752381 1:167734792-167734814 TTGCCTCAGATGTGGGTGGATGG + Intronic
917651041 1:177077782-177077804 GGGCCTCAGGAAAGGCTGGCTGG - Intronic
918934118 1:190898207-190898229 GTGACTCAGGTTAGGCTACATGG + Intergenic
919744351 1:200999542-200999564 ATGCCTCAGGTGTGTCAGGAGGG + Intronic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
922601388 1:226857416-226857438 GTGCCTAGGGTGAGGTGGGAAGG - Intergenic
922770070 1:228176871-228176893 CTGCAGCGGGTGAGGCTGGACGG - Exonic
923564979 1:235069881-235069903 TTTCCTCAGATGACGCTGGATGG + Intergenic
1062952649 10:1516248-1516270 GGGCCTCGGGTCAGGATGGAGGG - Intronic
1064711789 10:18135090-18135112 GTGCCTTAGGTGATGGTAGATGG - Intergenic
1064727751 10:18298483-18298505 ATGCCACAGGTGAGGCCGTAAGG + Intronic
1066422643 10:35276804-35276826 GTGCCACAGGAGAGCCTGGAAGG - Intronic
1067509626 10:46884354-46884376 GGGCCTCAGCTGATTCTGGAGGG + Intergenic
1067652628 10:48167504-48167526 GGGCCTCAGCTGATTCTGGAGGG - Intronic
1068241863 10:54312740-54312762 GTGCCACAGCTGATGCTGCATGG + Intronic
1069853661 10:71426488-71426510 GGACTTCAGGTGAGGCAGGAGGG + Intronic
1069905622 10:71730596-71730618 GAGACTCTGGTGAGGCTGGCAGG + Intronic
1070432796 10:76358065-76358087 GCCCCTGAGGTGAGGGTGGAAGG - Intronic
1073295537 10:102436189-102436211 GGGCCTGATGTGGGGCTGGAGGG - Intergenic
1073571842 10:104587080-104587102 TTGCCCCAGATGAGGCAGGAAGG - Intergenic
1075576425 10:123580877-123580899 GTGGCCCAGGTGAGGCTGGAGGG - Intergenic
1075815213 10:125259833-125259855 GTCACTCAGTGGAGGCTGGATGG - Intergenic
1076668262 10:132104981-132105003 GGGCCCCAGGGGAGGCAGGAGGG - Intronic
1076807255 10:132865181-132865203 GTGTCTGAGGTGAGTTTGGAGGG + Intronic
1077194172 11:1271005-1271027 GGGCCCCAGAAGAGGCTGGAAGG - Intergenic
1078600505 11:12726240-12726262 GTACCTCTGGTGAGACTTGAAGG + Intronic
1078881654 11:15455854-15455876 GTGTTTCTGGTGAGGCAGGATGG + Intergenic
1079105982 11:17572740-17572762 GTGTATGAGGTGAGGCAGGAGGG - Intronic
1079269580 11:18971787-18971809 ATGCCTGAGGTGAAGGTGGAGGG - Intergenic
1083491732 11:63019018-63019040 CTGCCTCCTCTGAGGCTGGAGGG - Intergenic
1083763865 11:64832980-64833002 GTGGATGAGGTGAGGCTGGGAGG + Intronic
1083802140 11:65052991-65053013 GTGCCTCCCGTGTGCCTGGATGG - Intronic
1083853030 11:65378887-65378909 GGGCCTCAGGTGAGGCTCCCAGG + Intronic
1084155872 11:67312199-67312221 GTGCCACAGGTGAGTGTGCAGGG - Exonic
1084320951 11:68373116-68373138 GAGCCTCAGGTGAGACTCAAGGG + Intronic
1084650514 11:70486780-70486802 GTGCTCCGGGTGAGGCTGGGAGG - Intronic
1085511125 11:77088667-77088689 GTGACTAGGGTGAAGCTGGATGG + Intronic
1086969754 11:93067410-93067432 CTGCCTCAGGAGAGGATGGGGGG + Intergenic
1090361120 11:126173426-126173448 GTGCCTCAGGCCAGGCTGCGTGG - Intergenic
1090977407 11:131689348-131689370 TTGGCTCAGGAGGGGCTGGAAGG + Intronic
1091563767 12:1633123-1633145 CTGCCCCAAGTGAGGCTGGAAGG - Intronic
1091877098 12:3944439-3944461 GGGACTGAGGTGAGGGTGGAGGG - Intergenic
1092008823 12:5092029-5092051 GTGCCTGGGGTGATGATGGATGG - Intergenic
1093131781 12:15400358-15400380 GTGCAGCAGGTGAGGCTGCTGGG - Intronic
1093422332 12:18988669-18988691 GAGGCTGAGGTGAGGCAGGAGGG - Intergenic
1095854409 12:46844447-46844469 TAGCATCAGGAGAGGCTGGAGGG + Intergenic
1096340238 12:50791778-50791800 GGACCTGAGGTGAGCCTGGAGGG + Intronic
1096828234 12:54295381-54295403 TTCCCTCAGGGGAAGCTGGAGGG - Exonic
1097024416 12:56043868-56043890 GTGCCTCAGGTTAAGCTGTAAGG + Intronic
1098482978 12:70987134-70987156 GTGCCTTAGGAGAGGATAGAGGG - Intergenic
1099005980 12:77235274-77235296 GTTCCTCTGGAGAGGCAGGATGG + Intergenic
1099289194 12:80754448-80754470 GAGCCTCAGATGGGGGTGGAAGG - Intergenic
1101119248 12:101562115-101562137 GTTTTTCAGGTGAGGCTGGAGGG - Intergenic
1102289292 12:111685823-111685845 CGGGCTCAGGCGAGGCTGGAAGG + Exonic
1103520242 12:121533133-121533155 GAGCCTCTGGGGAGGCAGGAAGG + Intronic
1103742541 12:123100812-123100834 CTGCCTCAGGTGAGTCTGACTGG - Intronic
1103859664 12:124002300-124002322 GTGCAGGAGGTGAGGTTGGAAGG + Intronic
1103960364 12:124605665-124605687 GGGGCTCAGCTGGGGCTGGATGG - Intergenic
1104036447 12:125100728-125100750 GGGCCCCAGGTGAGGCTGACTGG + Intronic
1104074907 12:125380487-125380509 GTGATTCATCTGAGGCTGGAAGG - Intronic
1104955175 12:132461229-132461251 GGGCCTCAGGAGCAGCTGGAAGG - Intergenic
1106128766 13:26922307-26922329 GTGGCTCAGGTGAGGCGAGGGGG - Intergenic
1106825351 13:33514573-33514595 GTGCCACAATGGAGGCTGGAGGG + Intergenic
1107457045 13:40564580-40564602 TGGCCACAGGAGAGGCTGGATGG + Intronic
1107939124 13:45368847-45368869 GTGCCTGAGGGGAGCCAGGAAGG - Intergenic
1108271668 13:48767080-48767102 TTGCCTCAGGTGAGCCTTGGAGG + Intergenic
1113532991 13:111042823-111042845 GTGCCTAACGCCAGGCTGGATGG - Intergenic
1113692371 13:112320325-112320347 GTGGGTGAGTTGAGGCTGGAGGG - Intergenic
1114277496 14:21160316-21160338 GAGCCTCAATTGGGGCTGGATGG + Intergenic
1116547440 14:46186556-46186578 GTGGCGGGGGTGAGGCTGGAGGG - Intergenic
1119151336 14:72362483-72362505 ATGGCTCAACTGAGGCTGGAGGG + Intronic
1119391776 14:74295863-74295885 GTGCATCAGGAGAAGCTGGAGGG - Exonic
1119719733 14:76882887-76882909 GTGCCCCAGCTGTGGCTGCAGGG + Intergenic
1119897829 14:78235235-78235257 GTGTGCCAGGTGAGGCTGAAGGG - Intergenic
1121014670 14:90541338-90541360 GAGCGGCAGGTGAGGCTGGCAGG + Exonic
1121527338 14:94628297-94628319 GTCACTCAGCTGGGGCTGGATGG + Intergenic
1121652064 14:95566061-95566083 ATGCTTCAGGTGAAACTGGAAGG + Intergenic
1122232726 14:100314912-100314934 GTGGCTGGGGTGAGGCTGGCAGG - Intergenic
1122531995 14:102434768-102434790 GGGGCCCAGCTGAGGCTGGAAGG - Exonic
1122540758 14:102496556-102496578 GGGCCTCAGCTGAGCCAGGATGG + Intronic
1122636021 14:103130065-103130087 GTGCCTCCCCAGAGGCTGGACGG + Exonic
1123025377 14:105421377-105421399 GGCCCTCATGTCAGGCTGGAAGG - Intronic
1123886434 15:24732209-24732231 TGACCTCAGGTGAGGATGGATGG - Intergenic
1124397839 15:29320088-29320110 CTGCCTTAGGTGAGACAGGAAGG - Intronic
1124665729 15:31590835-31590857 GTGCCTTAGGGAAGGCTGGCTGG + Intronic
1125520689 15:40346350-40346372 CTGCATGAGGTGGGGCTGGAGGG + Intergenic
1125525180 15:40369889-40369911 GGGCTTCTGGTGAGGCTGGCAGG - Exonic
1127566773 15:60196962-60196984 GTGGATCACTTGAGGCTGGAGGG + Intergenic
1128673354 15:69591077-69591099 GTGCCACAGGGGTGGCTGCAGGG + Intergenic
1129011752 15:72424855-72424877 GTGGCAAAGATGAGGCTGGAAGG + Intergenic
1129516306 15:76159700-76159722 CAGCTTCAGTTGAGGCTGGATGG - Intronic
1129599758 15:76991903-76991925 GTGCCTCAGGCCAGGCTGTGGGG - Intergenic
1130303411 15:82697685-82697707 GGGCCTCAGATAATGCTGGAAGG - Intronic
1130573389 15:85069315-85069337 GGTCCTGAGGAGAGGCTGGATGG - Intronic
1131075047 15:89490240-89490262 GGGCCTCAGGGAAGCCTGGAAGG - Intronic
1131158895 15:90091671-90091693 ATGCCCCTGGGGAGGCTGGAGGG + Intronic
1131735225 15:95324990-95325012 GTGGCTCAGGTGGGCCTGAAGGG + Intergenic
1132142583 15:99407726-99407748 CAGCCTCAGGTCAGGCTGGAGGG + Intergenic
1132407445 15:101552368-101552390 GTGACTGAGCTGTGGCTGGAAGG + Intergenic
1132981464 16:2740438-2740460 GTGAGGAAGGTGAGGCTGGAGGG - Intergenic
1133014757 16:2934189-2934211 GTGGGGCAGGTCAGGCTGGAAGG - Intronic
1133116076 16:3578718-3578740 GTGGCTCAGGGGAGGTAGGAGGG + Intergenic
1133146274 16:3789039-3789061 GCGCCACAGGTGATTCTGGAAGG + Intronic
1133170591 16:3980486-3980508 CTGCCTCAGGAGAGGCTGGGCGG + Intronic
1133994746 16:10739933-10739955 GGGCCTGAGCTGAGGCAGGAGGG + Intergenic
1134190653 16:12118687-12118709 GTAACTCAGGTGAGGGTCGAGGG - Intronic
1134687557 16:16169481-16169503 GTCCTTAAGATGAGGCTGGAGGG - Intronic
1137396549 16:48119564-48119586 GAGGCTCAGGTGTGGCAGGAAGG - Intronic
1139799896 16:69514037-69514059 GTGCTTCAGCTCAGGCTTGAGGG + Intergenic
1141168654 16:81677346-81677368 GTGCCACAGGTGAGGAAAGACGG - Intronic
1141722639 16:85765314-85765336 CTGCCTCAGCTGAGGATGGAGGG + Intergenic
1141842677 16:86584168-86584190 AAGCATCAGATGAGGCTGGAAGG - Intergenic
1141991203 16:87611347-87611369 GTGCCTGAGTTGAGTCTGGAAGG + Intronic
1142693551 17:1621208-1621230 TTGCCTCAGGGGAGCCTGGGGGG - Intronic
1143864040 17:9911186-9911208 CTGCTGCAGGTGATGCTGGAAGG + Intronic
1143880296 17:10024673-10024695 GAGGCCCAGGTGAGGGTGGATGG - Intronic
1144672771 17:17142322-17142344 GTGGCTCAGGAGAGGCTGCCGGG + Intronic
1144702202 17:17347170-17347192 CTGCCTGAGGTCAGGCTGAACGG - Exonic
1145978869 17:28999710-28999732 GGGCCTCAGTGGAGGCTGAAGGG + Intronic
1147190255 17:38734245-38734267 GGGCCTCAGCTGGGGGTGGAGGG + Exonic
1149430449 17:56593135-56593157 GTGCTTGAGGTGGGGCTGGAGGG - Intergenic
1150976203 17:70089984-70090006 GTGAGACAGTTGAGGCTGGATGG - Intronic
1152620149 17:81359340-81359362 GGGGCTCAGGAGAGGATGGAGGG - Intergenic
1152706424 17:81845977-81845999 GCTCATCAGGTGGGGCTGGAGGG + Exonic
1152962135 18:86384-86406 CTTCATCAGGTGAGGGTGGAGGG - Intergenic
1157534880 18:48450888-48450910 ATGACTCATGTGAGGATGGATGG + Intergenic
1159023387 18:63161456-63161478 GGGCCTCAGCTGAGCCTCGAAGG - Intronic
1159771875 18:72555912-72555934 TGGCTTCAGGTGAGGCTTGAGGG + Intronic
1160012241 18:75115025-75115047 GAGTCTGGGGTGAGGCTGGAAGG - Intergenic
1160791270 19:924883-924905 GAGCCCCAGGGGAGCCTGGAGGG - Intergenic
1163528230 19:17834460-17834482 GTGTGTCTGGTGAGGTTGGAGGG - Intronic
1163641117 19:18462667-18462689 CTGCCTCAGGTTGGGCAGGATGG - Intronic
1163738679 19:18997323-18997345 GGGCCTCAGGTCAGGAGGGAGGG + Intronic
1164713774 19:30376990-30377012 GTCCATCAGGGGAGGCTGGCAGG + Intronic
1165489074 19:36112997-36113019 GGGCCCCAGGTGGGGATGGAAGG + Intronic
1165898116 19:39155475-39155497 GTGCCTCAAGTGGGGCCGGAGGG + Intronic
1165945203 19:39437688-39437710 GTTCCTCAGGTGGGGTTGGGGGG - Intronic
1166870027 19:45865326-45865348 TTGTCTGAGGTGAGACTGGATGG - Intronic
1168310802 19:55459640-55459662 GTGGCTGGGCTGAGGCTGGAGGG - Intronic
1168397629 19:56062474-56062496 GTTACTCAGGTGAGGCTGATTGG + Intergenic
925298990 2:2796480-2796502 GTGGCTGAGGGGAGCCTGGAAGG + Intergenic
925898114 2:8488668-8488690 GAGCTTCGTGTGAGGCTGGAGGG + Intergenic
926001867 2:9339811-9339833 GAGAGGCAGGTGAGGCTGGAAGG - Intronic
926194688 2:10755648-10755670 GTGGCTCTGGAGAGGGTGGAGGG - Intronic
926609056 2:14927093-14927115 GTGCTGCAGATGAAGCTGGAAGG - Intergenic
927046267 2:19281992-19282014 GTGCTTCATCTGAGGATGGAAGG - Intergenic
927092265 2:19721009-19721031 GTGACTCAGGTTTGGCTGGGTGG - Intergenic
928199626 2:29239387-29239409 GTGCTTCAGGTGAGGGAGGGGGG + Intronic
932357363 2:71077639-71077661 GAGCCTGGGGGGAGGCTGGAAGG + Intronic
933254433 2:80064560-80064582 GTGGCTCAGCTGGGGCTGGATGG + Intronic
938163146 2:129004542-129004564 GTCCCTGAGGAGATGCTGGATGG - Intergenic
938278012 2:130044739-130044761 GTGCCTCATGAAAGTCTGGAGGG - Intergenic
938328981 2:130435542-130435564 GTGCCTCATGAAAGTCTGGAGGG - Intergenic
938360966 2:130685950-130685972 GTGCCTCATGAAAGTCTGGAGGG + Intergenic
938418921 2:131127880-131127902 GGGCCTCAGCAGAGGCTGGACGG + Intronic
938437369 2:131292645-131292667 GTGCCTCATGAAAGTCTGGAGGG + Intronic
939178842 2:138781067-138781089 GTGCGCCTGGTGCGGCTGGAAGG + Intergenic
942930286 2:181483952-181483974 GTGCCTCAGGGTAGGCATGAGGG - Intronic
943321972 2:186455741-186455763 GTGCATCATGTGAGGCAGAAAGG - Intergenic
945058867 2:205891281-205891303 GCTCCTCAAGTGAGGCTGGGAGG - Intergenic
945186954 2:207148909-207148931 GGGAATCAGGTGAGGGTGGAGGG - Intronic
946552879 2:220822877-220822899 CTGCCTCAGGTGATTCTTGATGG - Intergenic
948142599 2:235684978-235685000 GTGCTCCAGGTGTGGCTGGTTGG + Intronic
948393857 2:237630736-237630758 GAGCCACTGGTGAGGCTGGCGGG - Intronic
948565612 2:238884363-238884385 GTGGCACAGGTGAGGCCGGAGGG + Intronic
948567983 2:238898545-238898567 GTGTCTCAGGAGCGGCTGGCGGG - Intronic
948862696 2:240760651-240760673 GAAGCTCAGGTGGGGCTGGAGGG - Exonic
1168764710 20:373773-373795 GGGCCTAAGGAGAGGCAGGAAGG - Intronic
1169109514 20:3022836-3022858 GTGGGTCAGGTGAGGGTGGGGGG + Intronic
1170594027 20:17792233-17792255 GTGCCTCGGGTGAAGCATGAAGG + Intergenic
1171340172 20:24421240-24421262 GTGACACATGTGAGGCTGGCTGG + Intergenic
1172989971 20:39028148-39028170 GTGGCTTAGGGGAGGTTGGAGGG + Intronic
1173619800 20:44428368-44428390 CTGCATCAGGTGAGGGTGCAGGG - Exonic
1173619980 20:44429515-44429537 GGGTCTCAGGGGTGGCTGGAAGG - Exonic
1174898635 20:54475877-54475899 GTGGCTCTGGGGAGGGTGGAGGG - Exonic
1175586272 20:60142960-60142982 CAGCCTTAGGTGAGACTGGAAGG + Intergenic
1175822779 20:61919424-61919446 GGGCCTCAGGTGAGACAGGAAGG - Intronic
1176102664 20:63371673-63371695 GTGCCTGCGGTGAGGCTGCCTGG + Intronic
1176160076 20:63643199-63643221 GAGCCTCTGGTGAGGGTGGGAGG - Intronic
1176268594 20:64223639-64223661 GATCTTCAGGAGAGGCTGGAGGG - Intronic
1179339082 21:40487455-40487477 TTGCATGAGGTGAGGCTGGAGGG + Intronic
1180719831 22:17899596-17899618 GTGCATCAGGGCAGGCTGAAAGG + Intronic
1181386315 22:22548385-22548407 GTGGCTCAGGGAAGGCAGGAGGG + Exonic
1181804544 22:25366973-25366995 GAGCCTCAGGTGAGACTCAAGGG - Intronic
1182444602 22:30382752-30382774 GAGCCCCAGGTGAGGATGGAGGG + Intronic
1182551812 22:31104768-31104790 GAGCCTCAGTTAAGGCAGGAGGG + Exonic
1183277990 22:36913442-36913464 CTGCGTCAGCTGAGGCTTGAAGG + Intergenic
1183725052 22:39583965-39583987 TGGCCTGAGATGAGGCTGGAGGG + Intronic
1184236355 22:43185340-43185362 CGGCCTAAGGTGAGGCAGGAGGG + Intronic
1184334359 22:43844702-43844724 GTGCCTAGGCTGAGGCTGGGAGG - Intronic
1184686097 22:46097022-46097044 CTGCCTCAAGTCAGGCTGGCAGG - Intronic
1184702795 22:46188077-46188099 GTGGCTCAGCTATGGCTGGATGG - Intronic
1184786272 22:46673455-46673477 GTGGCTCAGATGAGTCAGGAGGG + Intronic
949860112 3:8497693-8497715 GAGCCTCAGGTGAGGCATGCAGG - Intergenic
950268133 3:11590511-11590533 TTGCCTCTGCTGGGGCTGGAAGG + Intronic
951952255 3:28213270-28213292 ATGACTCAGCTGTGGCTGGAGGG + Intergenic
952142330 3:30494004-30494026 GTGCCTTATGGGCGGCTGGAGGG - Intergenic
954332559 3:49898706-49898728 GTGACTCAGGGGTGCCTGGAGGG + Intronic
954695518 3:52422873-52422895 CAGCCACAGGTGAGGCTGGAGGG + Exonic
959459247 3:106604413-106604435 ATGGGTCAGGTGAGGCTGGGTGG + Intergenic
959659149 3:108845937-108845959 ATTACTCACGTGAGGCTGGAAGG + Intronic
961492526 3:127265354-127265376 GGGCCACAGGGGAGGCTGGGTGG + Intergenic
965159456 3:165113282-165113304 GTGGCTCATGTGATGATGGAAGG + Intergenic
965510614 3:169565045-169565067 GTACCTCAGGGGTGGCTGTAAGG - Intronic
965691101 3:171357881-171357903 GGGCCGTAGATGAGGCTGGAGGG + Intronic
967053592 3:185807839-185807861 ATGGCTCAGCTGGGGCTGGAAGG - Intronic
967954616 3:194868850-194868872 TGGCTTCAGGTGAGGCTGGAGGG + Intergenic
968510908 4:995519-995541 GTCCCTCGGGTGGGGCTGGAAGG + Intronic
969364775 4:6687968-6687990 GTGCTTCAGATGAGACTTGAAGG - Intergenic
969581869 4:8070652-8070674 CTGCCACAGGGGAGGCTGGCAGG - Intronic
970229274 4:13891926-13891948 TTGCCTCATGTGAGGGTTGATGG + Intergenic
975013566 4:69383466-69383488 GTGTCTCAGCTGTGGCTGAAAGG + Intronic
975131893 4:70839595-70839617 GTGCCTCCCGGGAGGCTGGCGGG - Exonic
975489238 4:74970366-74970388 GTGGACCATGTGAGGCTGGACGG + Intronic
975585393 4:75943098-75943120 GTGGCTTAGCTGAGGCAGGAAGG - Intronic
977809830 4:101346521-101346543 ATGCCCCAAGTGAGGCTGGGTGG + Intronic
978403046 4:108350573-108350595 GGGCCTCAGGGGAAGCTGGATGG + Intergenic
980710374 4:136558554-136558576 GTGTCTCAGATGAGGAAGGATGG - Intergenic
982240677 4:153296451-153296473 GTGCCAGAGCTGAGGCTGTACGG + Intronic
982488161 4:155994128-155994150 GTGTCTCAGGTGTGGGTGGGGGG + Intergenic
984695489 4:182775313-182775335 GTGCAGCTGGGGAGGCTGGAGGG + Intronic
985511775 5:317727-317749 GGGCCCCAGGTGAGGGTGTACGG - Intronic
986681001 5:10232748-10232770 ATGGCCCAGGGGAGGCTGGAGGG + Intronic
988333537 5:29874874-29874896 GTGACTCAGGTGATCCTGCATGG + Intergenic
988564706 5:32312288-32312310 GTGCCTCGGGTGCGGCTGGCGGG - Intronic
988779088 5:34502900-34502922 GGGCCTAAGGTGAGGCTGGTGGG - Intergenic
992648938 5:78838390-78838412 GTGCCTGGAGTGAGGCTGGCCGG + Intronic
997302859 5:132819193-132819215 GTGCCTCAGGTGTGCCTGCAGGG + Intergenic
997381790 5:133443738-133443760 GGGCCTCCTATGAGGCTGGAGGG - Intronic
997681090 5:135751212-135751234 GGGCCTGAGCTGAGGCAGGAGGG - Intergenic
998265112 5:140662120-140662142 GGGCCTCAGGTGAGCTTAGATGG + Intronic
999305223 5:150515232-150515254 GTGCCTCAGCTGATGGTGGCAGG + Intronic
999319069 5:150602058-150602080 GTGCCCCCGATGAGTCTGGATGG - Intronic
999617161 5:153436741-153436763 GCACCTCAGGTGAGCCTGGAAGG - Intergenic
999780644 5:154847387-154847409 GGGAATAAGGTGAGGCTGGAAGG + Intronic
1001083958 5:168686965-168686987 GGGCTTCAGGTAAGGCAGGAGGG - Exonic
1002492250 5:179586808-179586830 GAGCCTCAGGTCAGGCAGGTCGG + Intronic
1002642757 5:180638295-180638317 GAGCCTTTGGTGGGGCTGGAGGG - Intronic
1002692866 5:181062830-181062852 GTGCAACAGGTGACCCTGGATGG + Intergenic
1004116514 6:12773420-12773442 GTGAATCAGGTGAGGCTAGATGG - Intronic
1005942444 6:30570978-30571000 GCCCATCAGGTGAGGCTGGTAGG - Intergenic
1005942548 6:30571552-30571574 GCCCATCAGGTGAGGCTGGTAGG + Exonic
1006338333 6:33432294-33432316 GGGCCCCAGTTGGGGCTGGAGGG - Intronic
1006671911 6:35734995-35735017 GGGCCTTAGGTGTGGCAGGAGGG + Intergenic
1006790363 6:36697430-36697452 GGGCCTGAAGTGAGGCAGGATGG + Intergenic
1006931951 6:37693989-37694011 GTGTCTCTGCTGAGGCTGGTAGG - Intronic
1007777003 6:44229463-44229485 GCCACTCAGGTGAGGCTGGAGGG + Exonic
1007817124 6:44532426-44532448 GTGGCAGAGCTGAGGCTGGATGG + Intergenic
1008646567 6:53520474-53520496 CTGCCGCAGGCGAGGGTGGAGGG - Intronic
1011942873 6:92864754-92864776 CTGCCTTAGGTGAGACAGGATGG + Intergenic
1013596636 6:111666454-111666476 GTGGCTCCCGTGAGGCTAGAAGG - Intronic
1013650789 6:112192614-112192636 GTGCCTATGGTCAGGCTGGCTGG + Intronic
1015198825 6:130555013-130555035 GAGCCAGAGGTGAGGCTGTAGGG + Intergenic
1016618244 6:146077891-146077913 CTGCTTCAGGTGAGCCAGGAGGG + Intronic
1017027787 6:150197044-150197066 GAGCCTGAGGGGAGGGTGGAAGG - Intronic
1018356403 6:163021810-163021832 GTGCCTCCCTTGAGGCAGGAAGG - Intronic
1018697632 6:166402754-166402776 GAGCCTCAGGGCAGGCTGGATGG - Intergenic
1019035170 6:169048513-169048535 ATTCCTCAGGTGTGGCTGGAGGG + Intergenic
1019328424 7:451023-451045 CTGCCTCTGCTGAGTCTGGACGG + Intergenic
1019341303 7:510327-510349 GTGCCCCTGGTGTGGCTGGTGGG - Intronic
1019516619 7:1442982-1443004 GTGCCTGAGGGAAGGCAGGAAGG - Intronic
1019528985 7:1494354-1494376 GAGCCCCAGGCGGGGCTGGAGGG + Intronic
1019616396 7:1964864-1964886 GTGCCGCAGGTGAGGCTCCTGGG + Intronic
1019634208 7:2066952-2066974 GAGCCTCAGCTGAGGCCGGGCGG + Intronic
1019850066 7:3546097-3546119 GTGCCTCAGGGTTGCCTGGAGGG + Intronic
1020855523 7:13416731-13416753 GTGTATCACGTGATGCTGGATGG + Intergenic
1021447298 7:20747358-20747380 GAGACTCAGGTGAGCCTGGGAGG - Intronic
1023358567 7:39392719-39392741 GAGGCTCAGGCGAGGCAGGACGG + Intronic
1023840230 7:44092950-44092972 CTGACTCAGGTGAGTGTGGACGG + Intergenic
1023902184 7:44490395-44490417 GTGCTGCAGGTGAGGCGGGCGGG - Exonic
1023986363 7:45099458-45099480 GTCTCTAAGGAGAGGCTGGAAGG + Intergenic
1024541669 7:50479932-50479954 GTGCCTGAGCTGAGGCAGGTGGG - Intronic
1025028872 7:55539583-55539605 GGGCCACATGTGAGGCTGAAAGG + Intronic
1025964602 7:66256778-66256800 GGGCCACAGGGCAGGCTGGAAGG - Intronic
1026737865 7:72960361-72960383 GAGTCTCAGGGGAGGCTGCATGG + Intronic
1026788900 7:73319162-73319184 GAGTCTCAGGGGAGGCTGCATGG + Intronic
1027105869 7:75404707-75404729 GAGTCTCAGGGGAGGCTGCATGG - Intronic
1028582569 7:92422907-92422929 GTGCCGGAGATGGGGCTGGAGGG + Intergenic
1028669557 7:93386051-93386073 AAGCCTCAGGTGAGTCTTGAAGG + Intergenic
1029532668 7:101135808-101135830 CTGGCTCAGGTGAGGCTCCACGG + Intronic
1029537417 7:101164549-101164571 GTGCCGGGGGTGAGGCGGGACGG + Exonic
1030102689 7:105960517-105960539 GGGTCTCATGTGAAGCTGGAGGG + Intronic
1031843499 7:126775870-126775892 GTGCAGCAGATGAAGCTGGAGGG - Intronic
1032566586 7:132953378-132953400 GTCCCTCAGGGCAGTCTGGAAGG - Intronic
1033229088 7:139582802-139582824 GTGCCTCAGGCCAGCCTGCACGG - Intronic
1033333866 7:140435971-140435993 GTGCCTCAGGCCAGGCGCGATGG + Intergenic
1033503348 7:141976131-141976153 TAGCCACAGGTGAGGCTGGAGGG + Intronic
1035323055 7:158046568-158046590 GGGCCTCAGGTCATGGTGGAAGG - Intronic
1035545542 8:479576-479598 GTGCCACACGTGTGGCTGAAAGG + Intergenic
1035635244 8:1139301-1139323 CTGTCTCAGCTGAGGCTGCAGGG + Intergenic
1035902240 8:3469727-3469749 CTGCCTAAGGTGAGGATGTAGGG - Intronic
1037232767 8:16679369-16679391 CTGCCTCTGGTGCAGCTGGATGG - Intergenic
1037891620 8:22626809-22626831 GTGCCTCAGGGGATGTTGGGGGG - Intronic
1037935576 8:22913168-22913190 GTGCATCAGGTGAGGGTTTAGGG - Intronic
1038873690 8:31523998-31524020 GTGCCTCAGTGGATGCTGCAGGG + Intergenic
1039103896 8:33970066-33970088 TTGCCTGAGGAGAGGGTGGATGG + Intergenic
1039792651 8:40887967-40887989 GGGCCTCATGGGAGGCAGGAGGG - Intronic
1041272445 8:56122479-56122501 CTGCCTCAAGTGGGGCTGCAGGG + Intergenic
1041869273 8:62615129-62615151 GTGCCTCAGGTGAGCCTCTGAGG - Intronic
1042334535 8:67616137-67616159 GTTGCTCAGGTGAGGCTTGGTGG - Intronic
1042869452 8:73384557-73384579 GAGGCTCAGTTGAGCCTGGAAGG + Intergenic
1044047097 8:87449628-87449650 GTGCCTCATGTTAGCCTGGGTGG - Intronic
1044463124 8:92470596-92470618 GTGCCTGAAGTGTGGCTGGCTGG + Intergenic
1048572346 8:135666602-135666624 GTGCCTCATGGGCGGCTGGGTGG + Intergenic
1049310136 8:141929486-141929508 GAGCCTCAGATGGGGTTGGAGGG + Intergenic
1049907167 9:228851-228873 GTGGCTCAAGTGAAGCTGTAGGG + Intronic
1050600273 9:7243459-7243481 GTGCCTCAAGGGAGTCTTGAAGG + Intergenic
1051272092 9:15365532-15365554 GTGTCTGAGGTGAAGCTGGCTGG - Intergenic
1053246130 9:36536033-36536055 TTGCCTCAGACGAGGCAGGAAGG + Intergenic
1053470041 9:38339892-38339914 GGGCCACAGGTGTGGATGGAAGG + Intergenic
1057441842 9:95089093-95089115 GTGCCTCAGCTGACTCTGAATGG + Intergenic
1057791837 9:98129834-98129856 GTAGCTCAGGTGAGGCTTGTCGG + Exonic
1058906661 9:109487470-109487492 GAGCCTCTGGTGAGGCCGGAAGG - Intronic
1059771945 9:117434885-117434907 CTGCCTTTGGTGAGGCTGGCAGG + Intergenic
1060039118 9:120284491-120284513 GTGACTCAGGTGAGGTTGGCAGG + Intergenic
1060189119 9:121581146-121581168 GCAGCTCAGGTGAGGCTGGGTGG + Intronic
1060871188 9:127041611-127041633 GTGCCTCACGTGAGGGGTGAGGG + Intronic
1061952469 9:133944041-133944063 GAGCCACAGGTGAGGCCCGAGGG + Intronic
1062423711 9:136496596-136496618 CTGCACCAGGTGAGGCTGGGTGG + Exonic
1062736005 9:138137733-138137755 CTTCATCAGGTGAGGGTGGAGGG + Intergenic
1187416775 X:19100097-19100119 GTGACTCAACTGAGGCTTGAAGG - Intronic
1187818794 X:23262678-23262700 GTTCCTGGGGTGAAGCTGGAGGG - Intergenic
1189363620 X:40371541-40371563 GTGCCTCAGGTGAGCCTGGAGGG + Intergenic
1189701148 X:43717022-43717044 GTGGTTAAGGTGAGGCAGGATGG + Intronic
1196022316 X:111003180-111003202 GTGCTGCAGGTGTGGCTCGAGGG - Intronic
1196829291 X:119763603-119763625 GTGCCTGATCTGAGGCTCGAGGG + Intergenic
1197842970 X:130769699-130769721 GTGTGTCAGGTGATGTTGGATGG - Intronic
1197875179 X:131095345-131095367 TTCCCTCAGGTGAGACAGGAAGG + Intergenic
1199764549 X:150931400-150931422 CTGCCTCAGGAGAGGATGAAGGG + Intergenic
1200234856 X:154463382-154463404 GTGGCTCAGGTGCGGGTCGATGG + Exonic
1200968480 Y:9124767-9124789 GTGCCACAGGTAAGCCAGGAGGG + Intergenic
1202142285 Y:21737415-21737437 GTGCCACAGGTAAGCCAGGAGGG - Intergenic
1202144580 Y:21766387-21766409 GTGCCACAGGTAAGCCAGGAGGG + Intergenic