ID: 907280733

View in Genome Browser
Species Human (GRCh38)
Location 1:53345638-53345660
Sequence TACAGGGTGATGAGGGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907280733_907280743 13 Left 907280733 1:53345638-53345660 CCCATGGCCCTCATCACCCTGTA No data
Right 907280743 1:53345674-53345696 ATTCCAGATCCTTCTCTGTTTGG No data
907280733_907280744 14 Left 907280733 1:53345638-53345660 CCCATGGCCCTCATCACCCTGTA No data
Right 907280744 1:53345675-53345697 TTCCAGATCCTTCTCTGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907280733 Original CRISPR TACAGGGTGATGAGGGCCAT GGG (reversed) Intergenic
No off target data available for this crispr