ID: 907281034

View in Genome Browser
Species Human (GRCh38)
Location 1:53347129-53347151
Sequence AGGGAGAAGCAAACTGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907281016_907281034 30 Left 907281016 1:53347076-53347098 CCTCCCAGCCAGGAAGAGGGTGT No data
Right 907281034 1:53347129-53347151 AGGGAGAAGCAAACTGGGGGAGG No data
907281018_907281034 26 Left 907281018 1:53347080-53347102 CCAGCCAGGAAGAGGGTGTTGCC No data
Right 907281034 1:53347129-53347151 AGGGAGAAGCAAACTGGGGGAGG No data
907281017_907281034 27 Left 907281017 1:53347079-53347101 CCCAGCCAGGAAGAGGGTGTTGC No data
Right 907281034 1:53347129-53347151 AGGGAGAAGCAAACTGGGGGAGG No data
907281026_907281034 -2 Left 907281026 1:53347108-53347130 CCCATCAGTGGGAATGGGTGAAG No data
Right 907281034 1:53347129-53347151 AGGGAGAAGCAAACTGGGGGAGG No data
907281019_907281034 22 Left 907281019 1:53347084-53347106 CCAGGAAGAGGGTGTTGCCTGCT No data
Right 907281034 1:53347129-53347151 AGGGAGAAGCAAACTGGGGGAGG No data
907281022_907281034 5 Left 907281022 1:53347101-53347123 CCTGCTCCCCATCAGTGGGAATG No data
Right 907281034 1:53347129-53347151 AGGGAGAAGCAAACTGGGGGAGG No data
907281027_907281034 -3 Left 907281027 1:53347109-53347131 CCATCAGTGGGAATGGGTGAAGG No data
Right 907281034 1:53347129-53347151 AGGGAGAAGCAAACTGGGGGAGG No data
907281025_907281034 -1 Left 907281025 1:53347107-53347129 CCCCATCAGTGGGAATGGGTGAA No data
Right 907281034 1:53347129-53347151 AGGGAGAAGCAAACTGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907281034 Original CRISPR AGGGAGAAGCAAACTGGGGG AGG Intergenic
No off target data available for this crispr