ID: 907281715

View in Genome Browser
Species Human (GRCh38)
Location 1:53351356-53351378
Sequence TGTGCTCTTTTTAGCACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907281715_907281718 -4 Left 907281715 1:53351356-53351378 CCTCCTGTGCTAAAAAGAGCACA No data
Right 907281718 1:53351375-53351397 CACAGGTTTTAGAGTCAGACAGG No data
907281715_907281723 30 Left 907281715 1:53351356-53351378 CCTCCTGTGCTAAAAAGAGCACA No data
Right 907281723 1:53351409-53351431 GGCCCTGCTGCTTACACACCGGG No data
907281715_907281722 29 Left 907281715 1:53351356-53351378 CCTCCTGTGCTAAAAAGAGCACA No data
Right 907281722 1:53351408-53351430 AGGCCCTGCTGCTTACACACCGG No data
907281715_907281720 9 Left 907281715 1:53351356-53351378 CCTCCTGTGCTAAAAAGAGCACA No data
Right 907281720 1:53351388-53351410 GTCAGACAGGCCTGGTTCAGAGG No data
907281715_907281719 1 Left 907281715 1:53351356-53351378 CCTCCTGTGCTAAAAAGAGCACA No data
Right 907281719 1:53351380-53351402 GTTTTAGAGTCAGACAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907281715 Original CRISPR TGTGCTCTTTTTAGCACAGG AGG (reversed) Intergenic
No off target data available for this crispr