ID: 907281750

View in Genome Browser
Species Human (GRCh38)
Location 1:53351581-53351603
Sequence CAGCGGGAACAGAGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907281750_907281755 -5 Left 907281750 1:53351581-53351603 CCCTCTTCTCTCTGTTCCCGCTG No data
Right 907281755 1:53351599-53351621 CGCTGCTGTGGTTCCTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907281750 Original CRISPR CAGCGGGAACAGAGAGAAGA GGG (reversed) Intergenic
No off target data available for this crispr