ID: 907284762

View in Genome Browser
Species Human (GRCh38)
Location 1:53372544-53372566
Sequence CTCCACACGGCCTCATTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907284758_907284762 -8 Left 907284758 1:53372529-53372551 CCTGGGACAGGGCTGCTCCACAC No data
Right 907284762 1:53372544-53372566 CTCCACACGGCCTCATTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907284762 Original CRISPR CTCCACACGGCCTCATTTTG GGG Intergenic
No off target data available for this crispr