ID: 907285200

View in Genome Browser
Species Human (GRCh38)
Location 1:53375673-53375695
Sequence CGGAGTGAGCTGTTCAGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907285200_907285215 27 Left 907285200 1:53375673-53375695 CCGGGTCTGAACAGCTCACTCCG No data
Right 907285215 1:53375723-53375745 CGGGGCCTTGGGCGGAAGCTGGG No data
907285200_907285212 19 Left 907285200 1:53375673-53375695 CCGGGTCTGAACAGCTCACTCCG No data
Right 907285212 1:53375715-53375737 GGGACTACCGGGGCCTTGGGCGG No data
907285200_907285203 -3 Left 907285200 1:53375673-53375695 CCGGGTCTGAACAGCTCACTCCG No data
Right 907285203 1:53375693-53375715 CCGGCAGCCACTGAGCTGAGAGG No data
907285200_907285208 8 Left 907285200 1:53375673-53375695 CCGGGTCTGAACAGCTCACTCCG No data
Right 907285208 1:53375704-53375726 TGAGCTGAGAGGGGACTACCGGG No data
907285200_907285214 26 Left 907285200 1:53375673-53375695 CCGGGTCTGAACAGCTCACTCCG No data
Right 907285214 1:53375722-53375744 CCGGGGCCTTGGGCGGAAGCTGG No data
907285200_907285209 9 Left 907285200 1:53375673-53375695 CCGGGTCTGAACAGCTCACTCCG No data
Right 907285209 1:53375705-53375727 GAGCTGAGAGGGGACTACCGGGG No data
907285200_907285211 16 Left 907285200 1:53375673-53375695 CCGGGTCTGAACAGCTCACTCCG No data
Right 907285211 1:53375712-53375734 GAGGGGACTACCGGGGCCTTGGG No data
907285200_907285207 7 Left 907285200 1:53375673-53375695 CCGGGTCTGAACAGCTCACTCCG No data
Right 907285207 1:53375703-53375725 CTGAGCTGAGAGGGGACTACCGG No data
907285200_907285210 15 Left 907285200 1:53375673-53375695 CCGGGTCTGAACAGCTCACTCCG No data
Right 907285210 1:53375711-53375733 AGAGGGGACTACCGGGGCCTTGG No data
907285200_907285204 -2 Left 907285200 1:53375673-53375695 CCGGGTCTGAACAGCTCACTCCG No data
Right 907285204 1:53375694-53375716 CGGCAGCCACTGAGCTGAGAGGG No data
907285200_907285205 -1 Left 907285200 1:53375673-53375695 CCGGGTCTGAACAGCTCACTCCG No data
Right 907285205 1:53375695-53375717 GGCAGCCACTGAGCTGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907285200 Original CRISPR CGGAGTGAGCTGTTCAGACC CGG (reversed) Intergenic