ID: 907285202

View in Genome Browser
Species Human (GRCh38)
Location 1:53375693-53375715
Sequence CCTCTCAGCTCAGTGGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907285202_907285214 6 Left 907285202 1:53375693-53375715 CCGGCAGCCACTGAGCTGAGAGG No data
Right 907285214 1:53375722-53375744 CCGGGGCCTTGGGCGGAAGCTGG No data
907285202_907285210 -5 Left 907285202 1:53375693-53375715 CCGGCAGCCACTGAGCTGAGAGG No data
Right 907285210 1:53375711-53375733 AGAGGGGACTACCGGGGCCTTGG No data
907285202_907285212 -1 Left 907285202 1:53375693-53375715 CCGGCAGCCACTGAGCTGAGAGG No data
Right 907285212 1:53375715-53375737 GGGACTACCGGGGCCTTGGGCGG No data
907285202_907285219 26 Left 907285202 1:53375693-53375715 CCGGCAGCCACTGAGCTGAGAGG No data
Right 907285219 1:53375742-53375764 TGGGAGAACAGAGCGGATGAGGG No data
907285202_907285215 7 Left 907285202 1:53375693-53375715 CCGGCAGCCACTGAGCTGAGAGG No data
Right 907285215 1:53375723-53375745 CGGGGCCTTGGGCGGAAGCTGGG No data
907285202_907285217 19 Left 907285202 1:53375693-53375715 CCGGCAGCCACTGAGCTGAGAGG No data
Right 907285217 1:53375735-53375757 CGGAAGCTGGGAGAACAGAGCGG No data
907285202_907285218 25 Left 907285202 1:53375693-53375715 CCGGCAGCCACTGAGCTGAGAGG No data
Right 907285218 1:53375741-53375763 CTGGGAGAACAGAGCGGATGAGG No data
907285202_907285211 -4 Left 907285202 1:53375693-53375715 CCGGCAGCCACTGAGCTGAGAGG No data
Right 907285211 1:53375712-53375734 GAGGGGACTACCGGGGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907285202 Original CRISPR CCTCTCAGCTCAGTGGCTGC CGG (reversed) Intergenic