ID: 907285206

View in Genome Browser
Species Human (GRCh38)
Location 1:53375700-53375722
Sequence GTAGTCCCCTCTCAGCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907285206_907285220 25 Left 907285206 1:53375700-53375722 CCACTGAGCTGAGAGGGGACTAC No data
Right 907285220 1:53375748-53375770 AACAGAGCGGATGAGGGTCCAGG No data
907285206_907285218 18 Left 907285206 1:53375700-53375722 CCACTGAGCTGAGAGGGGACTAC No data
Right 907285218 1:53375741-53375763 CTGGGAGAACAGAGCGGATGAGG No data
907285206_907285215 0 Left 907285206 1:53375700-53375722 CCACTGAGCTGAGAGGGGACTAC No data
Right 907285215 1:53375723-53375745 CGGGGCCTTGGGCGGAAGCTGGG No data
907285206_907285217 12 Left 907285206 1:53375700-53375722 CCACTGAGCTGAGAGGGGACTAC No data
Right 907285217 1:53375735-53375757 CGGAAGCTGGGAGAACAGAGCGG No data
907285206_907285219 19 Left 907285206 1:53375700-53375722 CCACTGAGCTGAGAGGGGACTAC No data
Right 907285219 1:53375742-53375764 TGGGAGAACAGAGCGGATGAGGG No data
907285206_907285212 -8 Left 907285206 1:53375700-53375722 CCACTGAGCTGAGAGGGGACTAC No data
Right 907285212 1:53375715-53375737 GGGACTACCGGGGCCTTGGGCGG No data
907285206_907285214 -1 Left 907285206 1:53375700-53375722 CCACTGAGCTGAGAGGGGACTAC No data
Right 907285214 1:53375722-53375744 CCGGGGCCTTGGGCGGAAGCTGG No data
907285206_907285221 30 Left 907285206 1:53375700-53375722 CCACTGAGCTGAGAGGGGACTAC No data
Right 907285221 1:53375753-53375775 AGCGGATGAGGGTCCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907285206 Original CRISPR GTAGTCCCCTCTCAGCTCAG TGG (reversed) Intergenic