ID: 907285215

View in Genome Browser
Species Human (GRCh38)
Location 1:53375723-53375745
Sequence CGGGGCCTTGGGCGGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907285202_907285215 7 Left 907285202 1:53375693-53375715 CCGGCAGCCACTGAGCTGAGAGG No data
Right 907285215 1:53375723-53375745 CGGGGCCTTGGGCGGAAGCTGGG No data
907285200_907285215 27 Left 907285200 1:53375673-53375695 CCGGGTCTGAACAGCTCACTCCG No data
Right 907285215 1:53375723-53375745 CGGGGCCTTGGGCGGAAGCTGGG No data
907285206_907285215 0 Left 907285206 1:53375700-53375722 CCACTGAGCTGAGAGGGGACTAC No data
Right 907285215 1:53375723-53375745 CGGGGCCTTGGGCGGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907285215 Original CRISPR CGGGGCCTTGGGCGGAAGCT GGG Intergenic