ID: 907285727

View in Genome Browser
Species Human (GRCh38)
Location 1:53378285-53378307
Sequence CACAGCACGGTGTACTGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907285727_907285733 -2 Left 907285727 1:53378285-53378307 CCCTAACAGTACACCGTGCTGTG No data
Right 907285733 1:53378306-53378328 TGTGCAGCTCAGGGGATACGAGG No data
907285727_907285734 -1 Left 907285727 1:53378285-53378307 CCCTAACAGTACACCGTGCTGTG No data
Right 907285734 1:53378307-53378329 GTGCAGCTCAGGGGATACGAGGG No data
907285727_907285736 3 Left 907285727 1:53378285-53378307 CCCTAACAGTACACCGTGCTGTG No data
Right 907285736 1:53378311-53378333 AGCTCAGGGGATACGAGGGTGGG No data
907285727_907285737 8 Left 907285727 1:53378285-53378307 CCCTAACAGTACACCGTGCTGTG No data
Right 907285737 1:53378316-53378338 AGGGGATACGAGGGTGGGCCTGG No data
907285727_907285732 -10 Left 907285727 1:53378285-53378307 CCCTAACAGTACACCGTGCTGTG No data
Right 907285732 1:53378298-53378320 CCGTGCTGTGTGCAGCTCAGGGG No data
907285727_907285735 2 Left 907285727 1:53378285-53378307 CCCTAACAGTACACCGTGCTGTG No data
Right 907285735 1:53378310-53378332 CAGCTCAGGGGATACGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907285727 Original CRISPR CACAGCACGGTGTACTGTTA GGG (reversed) Intergenic
No off target data available for this crispr