ID: 907289298 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:53402619-53402641 |
Sequence | TTGAAGGTCAGGTTTCACCG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
907289298_907289303 | 8 | Left | 907289298 | 1:53402619-53402641 | CCCCGGTGAAACCTGACCTTCAA | No data | ||
Right | 907289303 | 1:53402650-53402672 | CAGCTTAAAGCCTGAAAACTAGG | No data | ||||
907289298_907289305 | 22 | Left | 907289298 | 1:53402619-53402641 | CCCCGGTGAAACCTGACCTTCAA | No data | ||
Right | 907289305 | 1:53402664-53402686 | AAAACTAGGCTGTCAGTTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
907289298 | Original CRISPR | TTGAAGGTCAGGTTTCACCG GGG (reversed) | Intergenic | ||