ID: 907289300

View in Genome Browser
Species Human (GRCh38)
Location 1:53402621-53402643
Sequence TCTTGAAGGTCAGGTTTCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907289300_907289303 6 Left 907289300 1:53402621-53402643 CCGGTGAAACCTGACCTTCAAGA No data
Right 907289303 1:53402650-53402672 CAGCTTAAAGCCTGAAAACTAGG No data
907289300_907289305 20 Left 907289300 1:53402621-53402643 CCGGTGAAACCTGACCTTCAAGA No data
Right 907289305 1:53402664-53402686 AAAACTAGGCTGTCAGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907289300 Original CRISPR TCTTGAAGGTCAGGTTTCAC CGG (reversed) Intergenic