ID: 907289303

View in Genome Browser
Species Human (GRCh38)
Location 1:53402650-53402672
Sequence CAGCTTAAAGCCTGAAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907289298_907289303 8 Left 907289298 1:53402619-53402641 CCCCGGTGAAACCTGACCTTCAA No data
Right 907289303 1:53402650-53402672 CAGCTTAAAGCCTGAAAACTAGG No data
907289296_907289303 28 Left 907289296 1:53402599-53402621 CCTAGGCAGACAGGATGGGTCCC No data
Right 907289303 1:53402650-53402672 CAGCTTAAAGCCTGAAAACTAGG No data
907289300_907289303 6 Left 907289300 1:53402621-53402643 CCGGTGAAACCTGACCTTCAAGA No data
Right 907289303 1:53402650-53402672 CAGCTTAAAGCCTGAAAACTAGG No data
907289301_907289303 -3 Left 907289301 1:53402630-53402652 CCTGACCTTCAAGACAAAGACAG No data
Right 907289303 1:53402650-53402672 CAGCTTAAAGCCTGAAAACTAGG No data
907289302_907289303 -8 Left 907289302 1:53402635-53402657 CCTTCAAGACAAAGACAGCTTAA No data
Right 907289303 1:53402650-53402672 CAGCTTAAAGCCTGAAAACTAGG No data
907289299_907289303 7 Left 907289299 1:53402620-53402642 CCCGGTGAAACCTGACCTTCAAG No data
Right 907289303 1:53402650-53402672 CAGCTTAAAGCCTGAAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907289303 Original CRISPR CAGCTTAAAGCCTGAAAACT AGG Intergenic