ID: 907289305

View in Genome Browser
Species Human (GRCh38)
Location 1:53402664-53402686
Sequence AAAACTAGGCTGTCAGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907289302_907289305 6 Left 907289302 1:53402635-53402657 CCTTCAAGACAAAGACAGCTTAA No data
Right 907289305 1:53402664-53402686 AAAACTAGGCTGTCAGTTCCAGG No data
907289298_907289305 22 Left 907289298 1:53402619-53402641 CCCCGGTGAAACCTGACCTTCAA No data
Right 907289305 1:53402664-53402686 AAAACTAGGCTGTCAGTTCCAGG No data
907289301_907289305 11 Left 907289301 1:53402630-53402652 CCTGACCTTCAAGACAAAGACAG No data
Right 907289305 1:53402664-53402686 AAAACTAGGCTGTCAGTTCCAGG No data
907289299_907289305 21 Left 907289299 1:53402620-53402642 CCCGGTGAAACCTGACCTTCAAG No data
Right 907289305 1:53402664-53402686 AAAACTAGGCTGTCAGTTCCAGG No data
907289300_907289305 20 Left 907289300 1:53402621-53402643 CCGGTGAAACCTGACCTTCAAGA No data
Right 907289305 1:53402664-53402686 AAAACTAGGCTGTCAGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907289305 Original CRISPR AAAACTAGGCTGTCAGTTCC AGG Intergenic