ID: 907291137

View in Genome Browser
Species Human (GRCh38)
Location 1:53413719-53413741
Sequence GGATTCTCCAGACTGCACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907291131_907291137 -2 Left 907291131 1:53413698-53413720 CCCATCACATGTCTCCCCTCTGG No data
Right 907291137 1:53413719-53413741 GGATTCTCCAGACTGCACTGTGG No data
907291133_907291137 -3 Left 907291133 1:53413699-53413721 CCATCACATGTCTCCCCTCTGGA No data
Right 907291137 1:53413719-53413741 GGATTCTCCAGACTGCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907291137 Original CRISPR GGATTCTCCAGACTGCACTG TGG Intergenic