ID: 907291137 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:53413719-53413741 |
Sequence | GGATTCTCCAGACTGCACTG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
907291131_907291137 | -2 | Left | 907291131 | 1:53413698-53413720 | CCCATCACATGTCTCCCCTCTGG | No data | ||
Right | 907291137 | 1:53413719-53413741 | GGATTCTCCAGACTGCACTGTGG | No data | ||||
907291133_907291137 | -3 | Left | 907291133 | 1:53413699-53413721 | CCATCACATGTCTCCCCTCTGGA | No data | ||
Right | 907291137 | 1:53413719-53413741 | GGATTCTCCAGACTGCACTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
907291137 | Original CRISPR | GGATTCTCCAGACTGCACTG TGG | Intergenic | ||