ID: 907294465

View in Genome Browser
Species Human (GRCh38)
Location 1:53440706-53440728
Sequence ATTCTGTTATAGGCTGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907294465_907294469 7 Left 907294465 1:53440706-53440728 CCGTGCCCAGCCTATAACAGAAT No data
Right 907294469 1:53440736-53440758 AAGTTCTAGATGAACAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907294465 Original CRISPR ATTCTGTTATAGGCTGGGCA CGG (reversed) Intergenic
No off target data available for this crispr