ID: 907296650

View in Genome Browser
Species Human (GRCh38)
Location 1:53459981-53460003
Sequence CGGTCCGCATCGGCCTGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 25}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907296650_907296661 21 Left 907296650 1:53459981-53460003 CCTGCGCAGGCCGATGCGGACCG 0: 1
1: 0
2: 0
3: 2
4: 25
Right 907296661 1:53460025-53460047 ACTTTGGTAAGTCGTGGCCTTGG 0: 1
1: 0
2: 0
3: 6
4: 59
907296650_907296656 5 Left 907296650 1:53459981-53460003 CCTGCGCAGGCCGATGCGGACCG 0: 1
1: 0
2: 0
3: 2
4: 25
Right 907296656 1:53460009-53460031 GGCCCACTGTTCACCGACTTTGG 0: 1
1: 0
2: 0
3: 3
4: 36
907296650_907296659 15 Left 907296650 1:53459981-53460003 CCTGCGCAGGCCGATGCGGACCG 0: 1
1: 0
2: 0
3: 2
4: 25
Right 907296659 1:53460019-53460041 TCACCGACTTTGGTAAGTCGTGG 0: 1
1: 0
2: 0
3: 1
4: 32
907296650_907296662 29 Left 907296650 1:53459981-53460003 CCTGCGCAGGCCGATGCGGACCG 0: 1
1: 0
2: 0
3: 2
4: 25
Right 907296662 1:53460033-53460055 AAGTCGTGGCCTTGGTCCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907296650 Original CRISPR CGGTCCGCATCGGCCTGCGC AGG (reversed) Exonic
907296650 1:53459981-53460003 CGGTCCGCATCGGCCTGCGCAGG - Exonic
922767420 1:228163227-228163249 CTGTCCGCATGGGGCTGCCCGGG + Intergenic
1070305082 10:75234979-75235001 TGCTCCGCCTCGGCCTGCGGAGG + Exonic
1075068386 10:119304809-119304831 TGGTCCGCATCTGCGTGCACAGG - Intronic
1077377357 11:2211297-2211319 CAGTCCGCAGGGGCCTGTGCAGG - Intergenic
1089327824 11:117669388-117669410 AGGTCCCCATCTGCCTGAGCTGG + Intronic
1103764541 12:123271302-123271324 CGATCCGCAGCCGCCGGCGCGGG + Intronic
1103927865 12:124433694-124433716 CGGTCTGCCTCGGACAGCGCAGG + Intronic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1117176490 14:53152200-53152222 CGGTGCGCATCGGCCCATGCAGG + Intronic
1122291168 14:100681218-100681240 CGGTCCCCAGCGGGCTGCTCAGG - Intergenic
1122921972 14:104884091-104884113 CGGTCCCTATCGGCCGGCGTTGG - Exonic
1142008494 16:87701725-87701747 CGGGCGGCATAGGCCTGAGCAGG - Intronic
1142711071 17:1724500-1724522 CGGTAGGCATCGCCCTCCGCCGG + Intronic
1152451220 17:80381671-80381693 TGGTCCACCTCGTCCTGCGCAGG + Exonic
1157354165 18:46917693-46917715 CAGTCCGCAGGGGCCTCCGCCGG - Intronic
1160789674 19:917706-917728 CGGTCCGCATCGGCTTGTGGCGG - Exonic
1161314915 19:3613288-3613310 CCGTCCACCTCGGCCTCCGCGGG + Exonic
1163700956 19:18786278-18786300 TGGTCCACATCCGCCTGCGGAGG + Exonic
1172447622 20:35001422-35001444 CTGTCCTCCTCGGCCTGGGCGGG - Exonic
1183702129 22:39456943-39456965 CGGCCCGGGGCGGCCTGCGCGGG - Intergenic
954063683 3:48089131-48089153 CGGTCCGCTTCGGCATTCGCAGG - Exonic
954795832 3:53161066-53161088 CCCTCCGCCTCTGCCTGCGCGGG - Intronic
968161773 3:196432513-196432535 CCGTCCCCAGCGGTCTGCGCAGG + Intergenic
980322521 4:131297427-131297449 CTGCCCGCCTCGGCCTGTGCTGG + Intergenic
1008763349 6:54880684-54880706 CTGTCCGCCTCGGCCTCCCCAGG + Intronic
1032037623 7:128531646-128531668 CGGGCAGCAGCCGCCTGCGCCGG - Intergenic
1062499146 9:136844911-136844933 CGGTGCGCAGCGGCCCGCGGCGG - Exonic