ID: 907296757

View in Genome Browser
Species Human (GRCh38)
Location 1:53460511-53460533
Sequence GTGCGCAGGCGCACTGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 2, 2: 4, 3: 16, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907296757_907296767 11 Left 907296757 1:53460511-53460533 CCTGGCCCAGTGCGCCTGCGCAC 0: 1
1: 2
2: 4
3: 16
4: 168
Right 907296767 1:53460545-53460567 GTTTCCCCACGTGCAGGTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 123
907296757_907296766 10 Left 907296757 1:53460511-53460533 CCTGGCCCAGTGCGCCTGCGCAC 0: 1
1: 2
2: 4
3: 16
4: 168
Right 907296766 1:53460544-53460566 CGTTTCCCCACGTGCAGGTGAGG 0: 1
1: 0
2: 1
3: 19
4: 121
907296757_907296763 5 Left 907296757 1:53460511-53460533 CCTGGCCCAGTGCGCCTGCGCAC 0: 1
1: 2
2: 4
3: 16
4: 168
Right 907296763 1:53460539-53460561 CCCTCCGTTTCCCCACGTGCAGG 0: 1
1: 0
2: 1
3: 45
4: 1320
907296757_907296768 12 Left 907296757 1:53460511-53460533 CCTGGCCCAGTGCGCCTGCGCAC 0: 1
1: 2
2: 4
3: 16
4: 168
Right 907296768 1:53460546-53460568 TTTCCCCACGTGCAGGTGAGGGG 0: 1
1: 0
2: 1
3: 12
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907296757 Original CRISPR GTGCGCAGGCGCACTGGGCC AGG (reversed) Intronic