ID: 907297133

View in Genome Browser
Species Human (GRCh38)
Location 1:53462409-53462431
Sequence CGAGCTTCACCCGGGCAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 54}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907297123_907297133 27 Left 907297123 1:53462359-53462381 CCTTAATGAAAGTCATTAGCTGC 0: 1
1: 0
2: 2
3: 12
4: 114
Right 907297133 1:53462409-53462431 CGAGCTTCACCCGGGCAGGTTGG 0: 1
1: 0
2: 1
3: 1
4: 54
907297128_907297133 -7 Left 907297128 1:53462393-53462415 CCAGTCCAATGGGGCTCGAGCTT 0: 1
1: 0
2: 0
3: 0
4: 52
Right 907297133 1:53462409-53462431 CGAGCTTCACCCGGGCAGGTTGG 0: 1
1: 0
2: 1
3: 1
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907297133 Original CRISPR CGAGCTTCACCCGGGCAGGT TGG Intronic
906444921 1:45888008-45888030 CGAGCTTTACCTGTGTAGGTGGG + Intronic
907297133 1:53462409-53462431 CGAGCTTCACCCGGGCAGGTTGG + Intronic
1075799926 10:125147280-125147302 CAGGCTTCACCTGGGCAGGGTGG + Intronic
1076378435 10:130008886-130008908 CAACCTTCTCCCGGGCAGCTAGG + Intergenic
1077015448 11:397163-397185 CCAGCTCCAGCCGGGCAGGGGGG + Exonic
1077537365 11:3130847-3130869 TGAGCTGCACCTGGGCAAGTAGG - Intronic
1084287751 11:68142768-68142790 CTTGCTGCACCGGGGCAGGTTGG + Intergenic
1096080566 12:48829711-48829733 CCAGCTTCTCCCTGGCAGGAGGG - Intergenic
1099405968 12:82262914-82262936 CAAGCTTCACAAGGGCAGGACGG - Intronic
1102346386 12:112163733-112163755 TGCTCCTCACCCGGGCAGGTGGG - Exonic
1104729699 12:131098044-131098066 CCAGCCTCACCTGGGCAGGCTGG + Intronic
1113832889 13:113310850-113310872 GCAGCTTCAGCCGGGGAGGTAGG + Exonic
1129850245 15:78789632-78789654 CGAGCTTCACCCTCGCAGCCTGG - Intronic
1139517847 16:67462266-67462288 CCAGCCTCACCCTGGGAGGTGGG + Intronic
1142191959 16:88722213-88722235 CGAGCTGCTCCTGGACAGGTGGG - Exonic
1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG + Intergenic
1146887627 17:36483126-36483148 CGCGCTCCACCCGGGCAGTGCGG + Intergenic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1152740733 17:82017226-82017248 AGTGCTTCAGCCGGGCTGGTGGG + Intronic
1154494825 18:14947942-14947964 CCAGCTTTGCCCGGCCAGGTAGG + Intergenic
1157276210 18:46312755-46312777 CCAGCCTCCCCTGGGCAGGTGGG - Intergenic
1157527220 18:48393163-48393185 CGAGTCCCACCCTGGCAGGTGGG - Intronic
1160425745 18:78778056-78778078 GGAGCTGCTCCCCGGCAGGTGGG + Intergenic
925395258 2:3528840-3528862 AGAGCTGCGCCCGGGAAGGTGGG - Intergenic
937040356 2:118815982-118816004 TGAGCTTGACCAAGGCAGGTGGG - Intergenic
948159465 2:235812306-235812328 CGGGCTTGCCCCGGGCAGGCCGG - Intronic
1172119881 20:32592019-32592041 CCAGCCTCACCCAGGCAGGGAGG + Intronic
1176929545 21:14791717-14791739 CGACCTTCATCCGGGCACGGTGG - Intergenic
1184281936 22:43442348-43442370 CGAGGTGCACCCAGGCAGGAAGG - Intronic
1184361145 22:44019505-44019527 CCAGCTTCAGCCGGGCACGGTGG - Intronic
953374011 3:42413510-42413532 CCTGCTGCACCCTGGCAGGTGGG - Intergenic
955909876 3:63849098-63849120 CTAGCTTCACCTGGGCATGGTGG + Intronic
968080567 3:195843592-195843614 CGGGCTGCACCCGAGCAGGGTGG + Intergenic
984934820 4:184880886-184880908 CGATCTTCTCCCTGTCAGGTGGG - Intergenic
985391191 4:189492025-189492047 TGACCCTCACCCGGGTAGGTGGG + Intergenic
985936140 5:3100050-3100072 AGAGCATCCCCCGGGCAGGATGG - Intergenic
986608642 5:9546214-9546236 CGAGTTTCACCCCGGCGGGGAGG - Intergenic
988547996 5:32175434-32175456 CGACCTTCACCAAGACAGGTGGG - Intergenic
988941313 5:36151235-36151257 CGAGCTTTACCCGTGCACGCAGG - Intronic
998463847 5:142327511-142327533 TGAGCTTCACAAGGGCAGGGAGG - Intergenic
1001298231 5:170514252-170514274 CCAGCTTCCCCCAGGCAGCTGGG - Intronic
1001706569 5:173745294-173745316 GAAGCTGCCCCCGGGCAGGTTGG + Intergenic
1001720564 5:173853670-173853692 GGAGCTTCATTAGGGCAGGTGGG + Intergenic
1002042957 5:176527898-176527920 GGAGATTCGCCCAGGCAGGTGGG + Exonic
1002524647 5:179808132-179808154 CGGGCCTCCCCCGGGCGGGTGGG - Intronic
1014777501 6:125528025-125528047 CCAGCTTCACCCTGGCTGGAAGG + Intergenic
1019543282 7:1560893-1560915 CCAGCTGTACCCAGGCAGGTAGG - Intergenic
1023137589 7:37068224-37068246 AGAGTTTCACCCGGACAGCTGGG - Intronic
1028566021 7:92232121-92232143 AGAGTTTCACCAGGGCAGGCTGG + Intronic
1033158025 7:138972730-138972752 GGAGGTTCACCTGGGCAGGCAGG - Intronic
1034470633 7:151252597-151252619 GGTGCTTAGCCCGGGCAGGTAGG - Intronic
1039912295 8:41834933-41834955 CCAGCTTCTCCCGGGCAGCGGGG - Intronic
1043309978 8:78846855-78846877 CATGCTGCACCTGGGCAGGTAGG + Intergenic
1044867068 8:96582039-96582061 CGAGCTGCACCATGGCAGTTGGG - Intronic
1047381743 8:124371652-124371674 CGAGTTTCCCCCAGGCAGGTAGG - Intronic
1049206770 8:141367201-141367223 CGCGCTTCACCCGGGCAGGCTGG + Exonic
1185722744 X:2395269-2395291 CCTGCTTCACACGGGCAGGGAGG - Intronic