ID: 907298505

View in Genome Browser
Species Human (GRCh38)
Location 1:53470708-53470730
Sequence TGTCCTGAAGAAGCCGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907298505_907298515 14 Left 907298505 1:53470708-53470730 CCGGCGCCGGCTTCTTCAGGACA No data
Right 907298515 1:53470745-53470767 CAGCGTGGGTTAGGAGCTCGTGG No data
907298505_907298511 0 Left 907298505 1:53470708-53470730 CCGGCGCCGGCTTCTTCAGGACA No data
Right 907298511 1:53470731-53470753 CCGGGCCTCAGCCTCAGCGTGGG No data
907298505_907298513 5 Left 907298505 1:53470708-53470730 CCGGCGCCGGCTTCTTCAGGACA No data
Right 907298513 1:53470736-53470758 CCTCAGCCTCAGCGTGGGTTAGG No data
907298505_907298517 16 Left 907298505 1:53470708-53470730 CCGGCGCCGGCTTCTTCAGGACA No data
Right 907298517 1:53470747-53470769 GCGTGGGTTAGGAGCTCGTGGGG No data
907298505_907298509 -1 Left 907298505 1:53470708-53470730 CCGGCGCCGGCTTCTTCAGGACA No data
Right 907298509 1:53470730-53470752 ACCGGGCCTCAGCCTCAGCGTGG No data
907298505_907298516 15 Left 907298505 1:53470708-53470730 CCGGCGCCGGCTTCTTCAGGACA No data
Right 907298516 1:53470746-53470768 AGCGTGGGTTAGGAGCTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907298505 Original CRISPR TGTCCTGAAGAAGCCGGCGC CGG (reversed) Intergenic