ID: 907298509

View in Genome Browser
Species Human (GRCh38)
Location 1:53470730-53470752
Sequence ACCGGGCCTCAGCCTCAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907298508_907298509 -7 Left 907298508 1:53470714-53470736 CCGGCTTCTTCAGGACACCGGGC No data
Right 907298509 1:53470730-53470752 ACCGGGCCTCAGCCTCAGCGTGG No data
907298505_907298509 -1 Left 907298505 1:53470708-53470730 CCGGCGCCGGCTTCTTCAGGACA No data
Right 907298509 1:53470730-53470752 ACCGGGCCTCAGCCTCAGCGTGG No data
907298502_907298509 15 Left 907298502 1:53470692-53470714 CCTTTCAGACTTAGTTCCGGCGC No data
Right 907298509 1:53470730-53470752 ACCGGGCCTCAGCCTCAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907298509 Original CRISPR ACCGGGCCTCAGCCTCAGCG TGG Intergenic