ID: 907298510

View in Genome Browser
Species Human (GRCh38)
Location 1:53470731-53470753
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907298510_907298522 25 Left 907298510 1:53470731-53470753 CCGGGCCTCAGCCTCAGCGTGGG No data
Right 907298522 1:53470779-53470801 CCCGCTGCTGCCTTCCGTCAAGG No data
907298510_907298516 -8 Left 907298510 1:53470731-53470753 CCGGGCCTCAGCCTCAGCGTGGG No data
Right 907298516 1:53470746-53470768 AGCGTGGGTTAGGAGCTCGTGGG No data
907298510_907298517 -7 Left 907298510 1:53470731-53470753 CCGGGCCTCAGCCTCAGCGTGGG No data
Right 907298517 1:53470747-53470769 GCGTGGGTTAGGAGCTCGTGGGG No data
907298510_907298515 -9 Left 907298510 1:53470731-53470753 CCGGGCCTCAGCCTCAGCGTGGG No data
Right 907298515 1:53470745-53470767 CAGCGTGGGTTAGGAGCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907298510 Original CRISPR CCCACGCTGAGGCTGAGGCC CGG (reversed) Intergenic