ID: 907298517

View in Genome Browser
Species Human (GRCh38)
Location 1:53470747-53470769
Sequence GCGTGGGTTAGGAGCTCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907298508_907298517 10 Left 907298508 1:53470714-53470736 CCGGCTTCTTCAGGACACCGGGC No data
Right 907298517 1:53470747-53470769 GCGTGGGTTAGGAGCTCGTGGGG No data
907298505_907298517 16 Left 907298505 1:53470708-53470730 CCGGCGCCGGCTTCTTCAGGACA No data
Right 907298517 1:53470747-53470769 GCGTGGGTTAGGAGCTCGTGGGG No data
907298510_907298517 -7 Left 907298510 1:53470731-53470753 CCGGGCCTCAGCCTCAGCGTGGG No data
Right 907298517 1:53470747-53470769 GCGTGGGTTAGGAGCTCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907298517 Original CRISPR GCGTGGGTTAGGAGCTCGTG GGG Intergenic